Unlock instant, AI-driven research and patent intelligence for your innovation.

Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali

A canker bacteria and specific technology, which is applied in the field of specific PCR identification of peach branch canker bacteria, can solve problems such as differences at the molecular level, and achieve the effects of sensitive method, good specificity and easy operation.

Inactive Publication Date: 2011-11-02
SHANGHAI ACAD OF AGRI SCI +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the bacteria that harm peach branch ulcers and peach fruit rot are of the same genus and different species, their colony and spore forms are similar, but there are obvious differences at the molecular level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali
  • Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali
  • Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Collection and Acquisition of Pathogenic Bacterial Strains

[0034] Both the peach branch canker and peach fruit rot disease strains were collected from cankered branches and rotten fruit samples of juicy peaches and yellow peaches in Shanghai, Zhejiang and other places. After their diseased tissues were disinfected with surface sodium hypochlorite or alcohol, they were placed on potato sucrose agar medium (PSA) (200 grams of potatoes, 20 grams of sucrose, 20 grams of agar, 1000 ml of distilled water), and cultivated at 25°C for 2-3 days. Two days later, the hyphae growing from the diseased tissue were transferred to two other new PSA medium. One of the petri dishes continued to be cultivated to observe the morphology of the bacteria. figure 1 It is the observation result of the strain of peach branch canker, in which A is the early colony of the strain, which is white; B is the mid-term colony of the strain, and white particles appear; C is the later result ...

Embodiment 2

[0036] Example 2 Determination of Molecular Characteristic Sequences of Peach Branch Canker and Peach Fruit Rot Disease Strains

[0037] The peach canker canker bacterial strain and the peach fruit rot bacterial strain obtained by the above-mentioned collection were respectively treated with Cha's nutrient solution (sucrose 30g, sodium nitrate 3g, dipotassium hydrogen phosphate 1g, magnesium sulfate heptahydrate 0.5g, potassium chloride 0.5g, seven Ferrous sulfate water 0.01g, distilled water 1000 milliliters) 24 ℃, 100 r / min, dark conditions after cultivating for 4-5 days, filter with double-layer gauze to obtain the mycelia of the pathogen, and then use the urea extraction method to extract the genome of the mycelium of the pathogen DNA.

[0038] The specific steps of the urea extraction method are as follows: add 0.5 g of the ground mycelia sample to 10 mL of urea extract (7mol / LUrea, 50mmol / L Tris-HCl pH 8.0, 62.5mmol / L NaCl, 1% SDS), shake well , centrifuge at 12000r / min...

Embodiment 3

[0044] Example 3 Sequence similarity comparison of molecular characteristics of branch canker strains of juicy peaches and yellow peaches, and peach fruit rot strains

[0045] The similarity comparison was performed on the molecular characteristic sequences of the branch canker of peach and yellow peach, the strain of peach branch canker and the strain of peach fruit rot obtained above. Find that: the molecular feature sequence similarity of the branch canker of peach and yellow peach (SEQ ID No1 and 2) is 99%; The molecular characteristic sequence similarity of No 5) is 89%, and the specific alignment is as follows.

[0046] 1. Sequence similarity comparison of molecular characteristics of Peach canker sores and Peach canker sores (the places marked in gray are base differences):

[0047] Upper: SEQ ID No 1

[0048] Bottom: SEQ ID No 2

[0049]

[0050] cggcgcaggc cggccccctt ctggggggccc ctcgttcctg acgaggagca ggctcgccgg

[0051] cggcgcaggc cggccccctt ctggggggccc ctcgttc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a special PCR indentifying method of phomopsis amygdali. According to the method provided by the invention, PCR amplification is carried out by utilizing a primer pair 4, wherein a positive primer sequence is Pa-F2: 5'GCCGGCCCCCTTCTG3'; a negative primer sequence is Pa-R2: 5'GCCTGCCTCGTTTTTACACA3'. The specificity PCR identifying method of phomopsis amygdali, provided by the invention, can be used as an efficient way for identifying the phomopsis amygdali and other strains in and out of the genus of the phomopsis. The method provided by the invention has the advantages of high speed, high flexibility, good specificity, simpleness and convenience for operation and low needed experiment conditions, thereby extremely high practical value.

Description

technical field [0001] The invention belongs to the field of molecular diagnosis of harmful organisms, and in particular relates to a specific PCR identification method for peach branch canker fungus (Phomopsis amygdali). Background technique [0002] Peach (Prunus persica) is a temperate deciduous fruit tree, which is a kind of fruit tree native to my country. There are many varieties of peach trees. There are more than 3,000 varieties in the world, of which more than 1,000 are in my country. According to their adaptability to climatic conditions, growth characteristics and fruit characteristics, they can be divided into several groups of varieties. [0003] Classified by fruit characters and maturity period, the details are as follows: ① According to the fruit shape, it is divided into common peach and flat peach (ie flat peach). ②According to the presence or absence of fuzz on the peel, it can be divided into peaches and nectarines, among which nectarines are a single v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/645
Inventor 戴富明曾蓉陆金萍
Owner SHANGHAI ACAD OF AGRI SCI