Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Integrin peptide, anti-cd 18 ssa antibody for treatment of endotoxin-mediated pro-inflammatory responses and the use

An integrin, antibody technology, applied in the direction of anti-animal/human immunoglobulin, antibody, immunoglobulin, etc., can solve problems such as organ failure and death

Active Publication Date: 2011-11-09
THE UNIVERSITY OF HONG KONG
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the unrestrained and widespread release of pro-inflammatory cytokines in response to a severe bacterial infection can lead to deleterious activation of the coagulation system and leukocyte-mediated responses, which eventually lead to multi-organ failure and even death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Integrin peptide, anti-cd 18 ssa antibody for treatment of endotoxin-mediated pro-inflammatory responses and the use
  • Integrin peptide, anti-cd 18 ssa antibody for treatment of endotoxin-mediated pro-inflammatory responses and the use
  • Integrin peptide, anti-cd 18 ssa antibody for treatment of endotoxin-mediated pro-inflammatory responses and the use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0060] The anti-CD18βA scFv antibodies and integrin peptides disclosed herein are polypeptides that can be in the form of the specific sequences disclosed herein or as variants of the sequences disclosed herein. Polypeptides can be formulated into compositions in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (salts with free amino groups) formed with inorganic acids such as hydrochloric acid or phosphoric acid, or with organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as sodium, potassium, ammonium, calcium, or ferric hydroxides, and organic bases, such as isopropylamine, trimethylamine, histidine, common Lucain et al.

[0061] Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethyle...

Embodiment 1

[0092] a. Preparation of integrin peptides

[0093] Integrin peptides are polypeptides produced recombinantly and purified from prokaryotic expression systems. Integrin peptides were prepared as described in (Wong KF et al., 2007). 简言之,将编码肽的cDNA,5’-ACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTACAATAAACTC-3’(SEQID NO.2)使用AmpliTaq Gold DNA聚合酶通过聚合酶链式反应(PCR)扩增。 The DNA template used for PCR was the human CD18 cDNA construct, a kind gift of Dr. Lloyd B. Klickstein (Harvard Medical School, Boston, MA, USA). PCR conditions were according to the manufacturer's instructions: denaturation at 94°C for 1 min, annealing at 55°C for 30 s, and extension at 72°C for 1 min, 25 cycles. The resulting DNA fragments were purified and cloned into an expression vector called pET43.1-B via two restriction...

Embodiment 2

[0098] Cecal ligation and puncture (CLP) sepsis model

[0099] The therapeutic effect of this therapy in protecting patients against acute peritonitis was assessed using the cecal ligation-puncture (CLP) model. The CLP model is one of many rigorous models that simulate the septic response in human patients. To minimize potential changes that could result from surgery, all surgical procedures were performed by a board-qualified surgical veterinarian as described by Echtenacher B et al.

[0100] Prior to surgery, ICR mice were anesthetized with an intraperitoneal injection of 60 mg / kg sodium pentobarbital (Nembutal, Rhone Merieux, Pinkenba, QLD, Australia) in 0.3 ml sterile pyrogen-free saline. The cecum was exposed through a 15 mm anterior midline incision, and its distal end was ligated non-obstructively. The ligated cecum was then perforated twice with a 19 gauge needle. The perforated cecum was returned to the abdominal cavity and the incision was closed with small clips....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

Bacterial lipopolysaccharide (LPS) in systemic circulation triggers deleterious super-inflammatory response, which is key pathogenesis of many disorders like gram-negative sepsis and necrotizing enterocolitis. No effective therapeutic interventions are currently available for protection of patients against mortality. Disclosed are methods and therapeutic agents that ablate the biological toxicity of LPS in circulation (Integrin Peptide), and abrogate leukocyte infiltration into lung and liver and suppress adhesion molecule expression (Integrin Peptide and Anti-CD 18 ssA scFv). These therapeutic agents can be used alone, or in combination for treatment of endotoxin-mediated pro-inflammatory responses, particularly in cases of acute sepsis and necrotizing enterocolitis.

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of priority to Provisional Application Serial No. 61 / 080,558, filed July 14, 2008, which is incorporated herein by reference. technical field [0003] The present disclosure relates to methods and compositions for the treatment of endotoxin-mediated proinflammatory responses, and more particularly to the treatment of acute peritonitis and sepsis conditions. The use of an artificial single chain anti-CD18βA antibody (anti-CD18βA) and novel integrin peptides in the treatment of endotoxin-mediated pro-inflammatory responses is disclosed. Background technique [0004] Critically ill patients with acute sepsis are at immediate risk of death. Current management of these patients relies on the use of corticosteroids, antibiotics, fluid resuscitation and supportive care of the failing organ. However, these interventions are not effective enough to achieve 100% protection of patients from o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C07K14/705A61K38/17A61P31/00
CPCA61K2039/505C07K2317/622C07K16/2845A61P31/00A61P31/04
Inventor 陆满晴黄广辉潘冬平范上达
Owner THE UNIVERSITY OF HONG KONG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com