A kind of multifunctional shuttle expression vector and its construction method
A technology for shuttle expression vectors and expression vectors, which is applied in the field of shuttle vectors for Candida glycerologenicum, can solve the problems of restricting in-depth research of excellent strains, inability to use screening conditions, and high price, and achieve the goal of overcoming unusable, stable replication, and reducing cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Construction of pT-URA3
[0026] Primers URA3U1 and URA3R1 were designed using DNAMAN according to the URA3 gene sequence of Candida glycerogenes (GenBank No. AY623794). In order to facilitate the connection of the PCR fragment to the plasmid pGAPZB, a BglII restriction site was added to the 5' end of the upstream primer URA3U1. The 5' end of the downstream primer URA3R1 contains a BglII restriction site, so there is no need to add an additional BglII restriction site.
[0027] Upstream primer URA3U15′-GA AGATCT GTTCCGCGTATTCTAAGTG-3',
[0028] Downstream primer URA3R15'-GCTTTGGTGGTTTGGTTACCGTGAGG-3',
[0029] The underscore "_" indicates the introduced enzyme cleavage site.
[0030] The PCR program was: 95°C pre-denaturation for 5 min; 94°C denaturation for 50 s, 55°C annealing for 2 min, 72°C extension for 1 min, 30 cycles; 72°C extension for 10 min. After the product was recovered, it was connected to the T carrier, transformed into competent JM109, a...
Embodiment 2
[0031] Example 2 Construction of pGAPZU
[0032] The pT-URA3 obtained above was digested with BglII in a 500ul centrifuge tube. The enzyme digestion system was: 30ul of plasmid DNA, 5ul of 10×bufferH, 4ul of BglII, and 50ul of water. Then put it in a water bath at 37°C for 5 hours of enzymatic digestion. The pGAPZB plasmid DNA was digested with the same enzyme and the same method. The digested product of pGAPZB plasmid was treated in a 65°C water bath for half an hour to inactivate the BglII enzyme, and then CIAP 3ul and CIAP buffer 6ul were added, and then the centrifuge tube was placed in a 37°C water bath for one hour for dephosphorylation to prevent Digested fragments are self-ligated. Add the binding buffer solution to the system to be purified at a ratio of 8:1, mix thoroughly, add the solution to the centrifugal adsorption column, then put the adsorption column into the waste liquid collection tube, and centrifuge at 8000r / min for 30s. (If the reaction system is less...
Embodiment 3
[0033] Example 3 Construction of the shuttle vector pGAPZBC
[0034] Primers were designed according to the CUP1 gene sequence in Saccharomyces cerevisiae W303-1A found on NCBI (GenBank sequence number is No. 856450). The primers used are
[0035] CUPF 1: CCG GAATTC ATCTGTTGTACTATCCGCTT
[0036] CUPR1: ATTT CCGC CGCTATACGTGCATATGTTC
[0037] To facilitate cloning, EcoRI and NotI restriction enzyme sites were added to CUPF1 and CUPR1, respectively.
[0038] The chromosomal DNA of Saccharomyces cerevisiae was used as a template, and CUPF1 and CUPR1 were used as primers for PCR amplification.
[0039] PCR reaction program: pre-denaturation at 95°C for 5 minutes. Denaturation at 94°C for 50s, annealing at 56°C for 1min, extension at 72°C for 1min, 30 cycles. Extend at 72°C for another 10 min.
[0040] The PCR fragment obtained above was digested with EcoRI and NotI, cloned into pGAPZB to construct the plasmid pGAPZBC, transformed into Escherichia coli, and the transformant...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 