A kind of multifunctional shuttle expression vector and its construction method

A technology for shuttle expression vectors and expression vectors, which is applied in the field of shuttle vectors for Candida glycerologenicum, can solve the problems of restricting in-depth research of excellent strains, inability to use screening conditions, and high price, and achieve the goal of overcoming unusable, stable replication, and reducing cost effect

Inactive Publication Date: 2011-12-21
JIANGNAN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Candida glycerologenicum is highly resistant to drugs such as hygromycin, G418, and cycloheximide, and these cannot be used as screening conditions for screening yeast transformants
Zeocin can be used to screen yeast transformants, but it is expensive, which greatly limits the in-depth study of this excellent strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of multifunctional shuttle expression vector and its construction method
  • A kind of multifunctional shuttle expression vector and its construction method
  • A kind of multifunctional shuttle expression vector and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Construction of pT-URA3

[0026] Primers URA3U1 and URA3R1 were designed using DNAMAN according to the URA3 gene sequence of Candida glycerogenes (GenBank No. AY623794). In order to facilitate the connection of the PCR fragment to the plasmid pGAPZB, a BglII restriction site was added to the 5' end of the upstream primer URA3U1. The 5' end of the downstream primer URA3R1 contains a BglII restriction site, so there is no need to add an additional BglII restriction site.

[0027] Upstream primer URA3U15′-GA AGATCT GTTCCGCGTATTCTAAGTG-3',

[0028] Downstream primer URA3R15'-GCTTTGGTGGTTTGGTTACCGTGAGG-3',

[0029] The underscore "_" indicates the introduced enzyme cleavage site.

[0030] The PCR program was: 95°C pre-denaturation for 5 min; 94°C denaturation for 50 s, 55°C annealing for 2 min, 72°C extension for 1 min, 30 cycles; 72°C extension for 10 min. After the product was recovered, it was connected to the T carrier, transformed into competent JM109, a...

Embodiment 2

[0031] Example 2 Construction of pGAPZU

[0032] The pT-URA3 obtained above was digested with BglII in a 500ul centrifuge tube. The enzyme digestion system was: 30ul of plasmid DNA, 5ul of 10×bufferH, 4ul of BglII, and 50ul of water. Then put it in a water bath at 37°C for 5 hours of enzymatic digestion. The pGAPZB plasmid DNA was digested with the same enzyme and the same method. The digested product of pGAPZB plasmid was treated in a 65°C water bath for half an hour to inactivate the BglII enzyme, and then CIAP 3ul and CIAP buffer 6ul were added, and then the centrifuge tube was placed in a 37°C water bath for one hour for dephosphorylation to prevent Digested fragments are self-ligated. Add the binding buffer solution to the system to be purified at a ratio of 8:1, mix thoroughly, add the solution to the centrifugal adsorption column, then put the adsorption column into the waste liquid collection tube, and centrifuge at 8000r / min for 30s. (If the reaction system is less...

Embodiment 3

[0033] Example 3 Construction of the shuttle vector pGAPZBC

[0034] Primers were designed according to the CUP1 gene sequence in Saccharomyces cerevisiae W303-1A found on NCBI (GenBank sequence number is No. 856450). The primers used are

[0035] CUPF 1: CCG GAATTC ATCTGTTGTACTATCCGCTT

[0036] CUPR1: ATTT CCGC CGCTATACGTGCATATGTTC

[0037] To facilitate cloning, EcoRI and NotI restriction enzyme sites were added to CUPF1 and CUPR1, respectively.

[0038] The chromosomal DNA of Saccharomyces cerevisiae was used as a template, and CUPF1 and CUPR1 were used as primers for PCR amplification.

[0039] PCR reaction program: pre-denaturation at 95°C for 5 minutes. Denaturation at 94°C for 50s, annealing at 56°C for 1min, extension at 72°C for 1min, 30 cycles. Extend at 72°C for another 10 min.

[0040] The PCR fragment obtained above was digested with EcoRI and NotI, cloned into pGAPZB to construct the plasmid pGAPZBC, transformed into Escherichia coli, and the transformant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multifunctional shuttle expression vector and a construction method thereof, belonging to the field of genetic engineering. The vector pGUGCA constructed in the present invention uses pGAPZB as the backbone, Candida glycerologenum URA3 sequence as the integration site, low-concentration Zeocin as the selection marker in Escherichia coli, and copper ion as the yeast selection marker. The shuttle vector pGUGCA obtained in this patent can be replicated in Escherichia coli, replicated and expressed in Candida glycerologenum. The vector realizes the use of low-concentration Zeocin as a selection marker in Escherichia coli and copper selection marker in yeast, which greatly reduces production and scientific research costs, and at the same time mediates the stability of the target gene in Candida glycerologenicum, an excellent host Express. The invention provides a convenient and cheap transformation system for glycerologenic Candida, which is highly resistant to fungal antibiotics such as hygromycin and G418, and the vector can be applied to Saccharomyces cerevisiae and Candida rugosa and other Saccharomyces. It provides a powerful tool for the genetic modification of yeast.

Description

technical field [0001] The invention relates to a multifunctional shuttle expression vector and a construction method thereof, in particular to a shuttle vector suitable for Candida glycerologenum. technical background [0002] Glycerologenic Candida is a wild-type glycerol high-producing strain. Compared with Saccharomyces cerevisiae, it has many advantages such as fast growth and fermentation speed, high osmotic pressure resistance, high glycerol yield, world leading conversion rate and sugar consumption conversion rate (Wang Zhengxiang, Zhuge Jian. High osmotic pressure and high pressure resistance A new species of Candida glycerol: Glycerologenic Candida [J]. Acta Microbiology. 1999, 39 (001): 68-74). The host cells used in genetic engineering technology have great prospects. On the other hand, in the process of large-scale production of biodiesel, more by-product glycerol will be produced, which weakens the advantages of fermentation to produce glycerol to a certain e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/65C12N15/66
Inventor诸葛斌高晓娜方慧英诸葛健
OwnerJIANGNAN UNIV