Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for the preparation of sensitive cell subclone vero/slam/v for enhanced pprv replication

A technology of sensitive cells and positive cells, applied in the direction of genetically modified cells, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of limiting PPRV wild strains, low isolation rate, virus loss, etc., to improve Effects of PPRV isolation rate, shortened lesion time, and simplified steps

Active Publication Date: 2020-09-01
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Virus isolation and identification are the basis of the research on the biological characteristics of the current popular PPRV strains, but PPRV is not easy to adapt to commonly used cell lines such as Vero, BHK-21, PK-15, or does not produce typical cytopathic changes (CPE), or The virus is lost after several passages, and the isolation rate is low, which affects and limits the research on the isolation, biological characteristics and pathogenic mechanism of PPRV wild strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for the preparation of sensitive cell subclone vero/slam/v for enhanced pprv replication
  • A method for the preparation of sensitive cell subclone vero/slam/v for enhanced pprv replication
  • A method for the preparation of sensitive cell subclone vero/slam/v for enhanced pprv replication

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Design and synthesize primers for the Slam / V functional region of the goat signaling lymphocyte activation molecule. The primers match the P site of the vector and can perform homologous recombination, that is, have a B site homology arm. The sequence is as follows:

[0040] SEQ ID NO.1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCTAGATCTGCGGAAAGGTGACT,

[0041] SEQ ID NO. 2: GGGGACAACTTTTGTATACAAAGTTGTGGCATGCTGAGGGCCAAGAGTGAG.

[0042] 2. Preparation of Goat Signaling Lymphocyte Activation Molecular RNA Template

[0043] The peripheral blood lymphocytes of healthy goats were collected and isolated, and their total RNA was extracted.

[0044] 3. Preparation of DNA of Slam / V functional region

[0045] Amplify the Slam / V functional region and establish a 50ul amplification system as follows:

[0046]

[0047] Click and mix the above to carry out RT-PCR amplification. The reaction conditions are:

[0048]

[0049] 4. Slam / V entry carrier construction

[0050] Gel reco...

Embodiment 2

[0066] 1-7 steps are with embodiment 1.

[0067] 8. Verification of slam / V gene expression in Vero / slam / V functional region cells by indirect immunofluorescence at the protein level

Embodiment example 1

[0068] The positive vero / slam / V functional region positive cell subclones screened in step 7 in Example 1 were inoculated on a 6-well cell culture plate with flyers added in advance, and after culturing for 48 hours, the flyers were taken out and washed with PBS buffer (pH7.6) Wash the cell surface twice, drain the liquid, add pre-cooled 80% acetone, put it in a -20°C refrigerator for 25 minutes, discard the acetone, and wash the monolayer cells three times with PBST buffer (pH 7.6). Block with PBS blocking solution containing 3-5% BSA for 45 min at room temperature. Discard the blocking solution and wash the cells 3 times with PBS. Goat anti-Slam primary antibody (Santa Cruz Biotechnology Co., Ltd.) diluted 1:200 in PBS was added to each well, reacted in a 37°C humid chamber for 1 hour, the primary antibody was discarded, and the monolayer cells were washed 3 times with PBST buffer. Add 1:500 dilution of FITC fluorescein isothiocyanate-labeled donkey anti-goat IgG to each we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of sensitive cell subcloning Vero / Slam / V for enhancing PPRV (Peste Des Petits Ruminants Virus) duplication. The preparation method comprises the steps of designing a goat signaling lymphocyte activation molecule Slam / V primer sequence; constructing a slam / V lentiviral expression vector; acquiring a slam / V replication-defective slow virus; screening and verifying slam / V slow virus infection target object cell Vero, and sensitive cell subcloning Vero / Slam / V; strengthening verification of PPRV susceptibility and the like. The preparation method provided by the invention comprises positive cell subcloning with the capability of enhancing PPRV duplication, the positive cell subcloning has a favorable biological property and hereditary stability, and the stable expressed Slam / V has an effect on remarkably enhancing PPRV duplication.

Description

technical field [0001] The invention relates to the preparation technology of sensitive cell subclone in the field of biology, in particular to a preparation method of sensitive cell subclone Vero / Slam / V for enhancing PPRV replication. Background technique [0002] Peste des petits ruminants (PPR) is caused by Peste despetits ruminants virus (PPRV), characterized by high fever (above 40°C), conjunctivitis, mucous or purulent discharge from the eyes and nose, oral ulcers Acute, febrile, highly contagious infectious disease characterized by pneumonia, cough, and foul-smelling diarrhea as the main clinical features, and pneumonia and hemorrhagic enteritis as the main pathological changes. The disease is a member of the genus Morbillivirus of the family Paramyxo-viridae, as well as rinderpest virus (RPV), canine distemper virus (CDV), seal distemper virus ( Porpoise distemper, PDV), dolphin plague virus (Dolphin distemper, DDV) and measles virus (Measles Virus, MV). Virus isol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N5/10
CPCC12N5/0686C12N15/86C12N2510/00C12N2740/15043
Inventor 吴锦艳张志东尚佑军田宏陈妍王光祥刘湘涛王耀杰张吉利
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com