Hepatitis C virus recombination protein and gene sequence

A hepatitis C virus and recombinant protein technology, applied in the field of genetic engineering, can solve the problems of false positive risk of rapid diagnosis products and missed detection of final diagnostic products, so as to reduce the risk of missed detection, reduce the risk of false positive, and avoid the risk of false positive Effect

Active Publication Date: 2012-01-18
杭州博林生物技术有限公司
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many shortcomings, such as: 1) the lack of other protein E1, E2 main epitopes, which can easily lead to missed detection of the final diagnostic product; 2) since most of the fragments are continuous, it is inevitable to add some The sequence of non-antigenic epitopes, which brings the risk of false positives to rapid diagnosis products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of recombinant vectors containing the hepatitis C virus core protein (core) gene

[0029] (1) Extraction of HCV virus

[0030] HCV RNA was extracted from human serum infected with HCV virus with a viral RNA extraction kit (Shanghai Sangon Bioengineering Service Co., Ltd., product number: SK1321).

[0031] (2) Recombinant vector construction of core protein gene

[0032]The upstream primer is (5'-3'): GCCCATATGAGCACGAATCCTAAACCT, with an NdeI restriction site, and the downstream primer is (5'-3'): CGCAAGCTTCCTACGCCGGGGGTCTG, with a HindIII restriction site, using the above primers to extract HCV RNA was used as a template, and the AMV RT-PCR kit (Shanghai Sangon Bioengineering Service Co., Ltd., article number: BS251) was used to prepare the HCV core region sequence according to the recommended conditions of the kit, and PCR (the polymerase of the present invention was a product of TOYOBO Company, Product number: 02510D1), PCR conditions are: 9...

Embodiment 2

[0033] Example 2: Screening monoclonal cells against hepatitis C virus core protein (core)

[0034] (1) Immunization: BALB / C mice, 6 weeks old, purchased from Shanghai Slack Experimental Animal Co., Ltd., each mouse was immunized with 50ug of core antigen, the first injection was emulsified with Freund’s complete adjuvant, the second, the third The first and fourth injections were emulsified with Freund's incomplete adjuvant, and the fifth injection was injected into the spleen, with an interval of 14 days between each injection.

[0035] (2) Fusion: 3 days after spleen injection, spleen cells were fused with mouse myeloma cells at a ratio of 5:1.

[0036] (3) Screening: positive cells were screened by ELISA method, and the positive cells were further cloned and screened until the monoclonal was stable. Specific method: use the core antigen 1ug / ml of the embodiment (1) and the embodiment (4), coat the microplate with 50ul per hole, seal the microplate with 1% BSA, take 50ul...

Embodiment 3

[0037] Example 3: Construction of single-chain antibodies against hepatitis C virus core protein (core)

[0038] (1) Extraction of cellular RNA

[0039] Total cellular RNA was extracted using TRIzol LS (product of Invitrogen, Cat. No. 10296-010) according to the instructions.

[0040] (2) Synthesis of the first strand of cDNA: Take 1 μg RNA as a template for reverse transcription, 1 μl of Oligo(d)T as a primer for reverse transcription, add DEPC water to a total volume of 12 μl, mix well; denature at 70°C for 5 minutes, and quickly cool in an ice bath; Add 4 μl of 5× buffer, 1 μl of RNase inhibitor, 2 μl of dNTP (10mM each), mix well; incubate at 37°C for 5 minutes; add 1 μl of AMV reverse transcriptase, reverse transcription at 37°C for 60 minutes; terminate the reaction at 70°C for 10 minutes; put on ice cool down.

[0041] (3) Using the reverse transcription cDNA as a template, use RT-PCR to amplify the heavy chain and light chain genes according to the following primer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses hepatitis C virus recombination protein, characterized in that: the hepatitis C virus recombination protein is fusion protein formed by fusing hepatitis C virus main antigenic determinant and hepatitis C virus core protein single chain antibody, and the amino acid sequence is represented as SEQ ID No.1. According to the invention, gene engineering recombination technology is utilized, the hepatitis C virus main antigenic determinant-core protein single chain antibody fusion protein is expressed in escherichia coli system, and the advantages of short production period, high yield and low cost are achieved. The recombination protein can be used as a part of an immunodiagnostic kit for hepatitis C virus.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a hepatitis C virus recombinant protein and gene sequence, which can be used for simultaneous detection of HCV antibody and core antigen. Background technique [0002] Hepatitis C is an infectious disease caused by hepatitis C virus (Hepatitis C Virus, HCV). Infected people are generally asymptomatic or have no obvious symptoms, but once infected, most of them will turn into chronic HCV infection, leading to chronic inflammation and necrosis of the liver And fibrosis, and even develop into liver cancer. At present, there are more than 170 million people infected with hepatitis C virus in the world. In the United States, nearly 40,000 people are newly infected with HCV every year, and about 85% of them are acutely infected. In China, the HCV infection rate is about 3.2%, and the number of people exceeds 40 million. It can be seen that HCV has caused great harm to human health....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N15/70G01N33/576
Inventor陈东吴晓杰张海燕
Owner杭州博林生物技术有限公司