Method for producing lactic acid from plant-derived raw material, and lactic-acid-producing bacterium

A technology of lactic acid and bacteria, applied in biochemical equipment and methods, bacteria, enzymes, etc., can solve problems such as low productivity and time-consuming sucrose assimilation

Active Publication Date: 2012-01-25
MITSUI CHEM INC
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] As described above, since the productivity of the existing method of producing lactic acid from sucrose is still low, and the assimilation of sucrose is still very time-consuming, it is still necessary to improve the technology for industrially producing lactic acid that fully utilizes sucrose that is cheap and has high industrial utilization value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing lactic acid from plant-derived raw material, and lactic-acid-producing bacterium
  • Method for producing lactic acid from plant-derived raw material, and lactic-acid-producing bacterium
  • Method for producing lactic acid from plant-derived raw material, and lactic-acid-producing bacterium

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0084] Any method can be used to prepare a gene disrupted strain as long as a disrupted strain not expressing the enzyme or protein can be obtained. Various methods of gene disruption have been reported (natural breeding, mutagen addition, ultraviolet irradiation, radiation exposure, random mutagenesis, transposons, site-specific gene disruption), but from the perspective that only a specific gene can be disrupted , preferably gene disruption by homologous recombination. The method utilizing homologous recombination is described in J.Bacteriol., 161, 1219-1221 (1985) or J.Bacteriol., 177, 1511-1519 (1995) or Proc.Natl.Acad.Sci.U.S.A, 97,6640- 6645 (2000), those skilled in the art can use the above method and its application to implement easily.

[0085] Escherichia coli in the present invention refers to Escherichia coli capable of producing lactic acid from plant-derived raw materials by using a certain method regardless of whether it itself has the ability to produce lactic...

Embodiment 1

[0113]

[0114] The entire base sequence of the genomic DNA of Escherichia coli is known (GenBank accession number U00096), and the base sequence of the gene (hereinafter also referred to as dld) encoding the FAD-dependent D-lactate dehydrogenase of Escherichia coli is also reported (GenBank accession number M10038).

[0115] Based on the gene information of the region near the dld gene of Escherichia coli MG 1655 strain genomic DNA, the following 4 kinds of oligonucleotide primers were synthesized: CAACACCAAGCTTTCGCG (sequence number 1), TTCCACTCCTTGTGGTGGC (sequence number 2), AACTGCAGAAATTACGGATGGCAGAG (sequence number 3) and TGTTCTAGAAAGTTCTTTGAC (sequence number 4).

[0116] Genomic DNA of Escherichia coli MG1655 strain was prepared by the method described in Current Protocols in Molecular Biology (JohnWiley & Sons). Using the obtained genomic DNA as a template, PCR was carried out under normal conditions using the primers of SEQ ID NO: 1 and SEQ ID NO: 2. This amplifi...

Embodiment 2

[0119] The plasmid pTHΔdld obtained in Example 1 was transformed into MG1655 strain at 30°C to obtain transformants propagated on LB agar plates containing 10 µg / ml chloramphenicol. The obtained transformant was spread on an agar plate, and cultured at 30° C. overnight. Then, in order to obtain the above-mentioned cultured cells, the cultured transformants were spread on LB agar plates containing 10 μg / ml chloramphenicol to obtain colonies that propagated at 42°C.

[0120] Furthermore, the operation of obtaining single colonies propagated at 42° C. was repeated again, and clones in which the entire plasmid was assembled into the chromosome by homologous recombination were selected. It was confirmed that the clone does not have a plasmid in its cytoplasm.

[0121] Then the above-mentioned clones were spread on LB agar plates, cultured overnight at 30° C., inoculated into LB liquid medium (3 ml / test tube), and cultured with shaking at 42° C. for 3 to 4 hours. To obtain single ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is a lactic-acid-producing Escherichia coli which has at least one gene including at least a sucrose hydrolase gene and selected from sucrose non-PTS genes (provided that a combination of a repressor protein (cscR), a sucrose hydrolase (cscA), a fructokinase (cscK) and a sucrose permease (cscB) and a combination of a sucrose hydrolase (cscA), a fructokinase (cscK) and a sucrose permease (cscB) are excluded) and is genetically so modified as to have a system for enhancing the production of lactic acid. Also disclosed is a method for producing lactic acid from a plant-derived sucrose-containing raw material by using the lactic-acid-producing Escherichia coli.

Description

technical field [0001] The present invention relates to a method for producing lactic acid from a plant-derived raw material and a lactic acid-producing bacterium. Background technique [0002] Lactic acid is a useful substance that has attracted attention in recent years as a polymer raw material or an intermediate of pesticides and drugs. Lactic acid includes L-lactic acid and D-lactic acid. The polylactic acid currently produced industrially is a polymer of L-lactic acid, but D-lactic acid has also attracted attention as a polymer raw material or an intermediate of pesticides and drugs in recent years. Microorganisms that efficiently produce lactic acid, such as lactic acid bacteria and filamentous bacteria, exist in nature. Among the methods for producing lactic acid using these bacteria, methods using Lactbacillus delbrueckii and the like as microorganisms that can efficiently produce L-lactic acid are known, and methods using Sporolactobacillus are also known. A metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/09C12P7/56
CPCC12N9/2451C12N9/1205C12P7/56C12N1/20
Inventor森重敬高桥克幸高桥均和田光史望月大资宫泽大辅安乐城正
OwnerMITSUI CHEM INC