Unlock instant, AI-driven research and patent intelligence for your innovation.

RCA (rolling circle amplification) rapid detection primer and kit for Yersinia enterocolitica

A technology for Yersinia enterocolitica and enterocolitis is applied in the field of rolling circle amplification rapid detection primers and kits for Yersinia enterocolitica, which can solve the problems of time-consuming and expensive application equipment, and achieve high High sensitivity and specificity

Inactive Publication Date: 2012-07-04
INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above-mentioned methods are either time-consuming or expensive, making it difficult to implement them in practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RCA (rolling circle amplification) rapid detection primer and kit for Yersinia enterocolitica

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Detection of Yersinia enterocolitica standard strain

[0046] Make the rolling circle amplification kit for Yersinia enterocolitica according to the following recipe:

[0047] 1) Probe binding reaction solution:

[0048] Each 8 μL contains 1 μL of 10×Taq DNA ligase buffer, 200 pmol L -1 Padlock probe 0.2μL, 40U·μL -1 Taq DNA ligase 0.1 μL, sterile double distilled water 6.7 μL.

[0049] The padlock probe described therein is SEQ ID NO: 3:

[0050] 5-GGACCATCAGGTGCGACATTTGCTTTCCCAATAGGTCCAGAATGTCAGCCGTTCCTCACCACCAGACTGCCATTCATCCGCTTATTATCACCGTTTGTCCTAATCTATG-3, 5' end phosphorylation modification;

[0051] 2) Exocut treatment reaction solution:

[0052] Each 10 μL contains 2 μL of 10× Exonuclease I buffer, 5 U·μL-1 Exonuclease I 3μL, sterile double distilled water 5μL.

[0053] 3) RCA constant temperature amplification reaction solution:

[0054] Each 21 μL contains 2.5 μL of 10×Bst DNA polymerase buffer, 10 μmol L -1 Primer XCF 1.25 μL, 10 μmol L -1 ...

Embodiment 2

[0069] Embodiment 2: the detection of Escherichia coli (ATCC 15922) standard bacterial strain

[0070] 1) Probe binding reaction solution:

[0071] Each 8 μL contains 1 μL of 10×Taq DNA ligase buffer, 200 pmol L -1 Padlock probe 0.2μL, 40U·μL -1 Taq DNA ligase 0.1 μL, sterile double distilled water 6.7 μL.

[0072] The padlock probe described therein is SEQ ID NO: 3:

[0073] 5-GGACCATCAGGTGCGACATTTGCTTTCCCAATAGGTCCAGAATGTCAGCCGTTCCTCACCACCAGACTGCCATTCATCCGCTTATTATCACCGTTTGTCCTAATCTATG-3, 5' end phosphorylation modification;

[0074] 2) Exocut treatment reaction solution:

[0075] Each 10 μL contains 2 μL of 10× Exonuclease I buffer, 5 U·μL -1 Exonuclease I 3μL, sterile double distilled water 5μL.

[0076] 3) RCA constant temperature amplification reaction solution:

[0077] Each 21 μL contains 2.5 μL of 10×Bst DNA polymerase buffer, 10 μmol L -1 Primer XCF 1.25 μL, 10 μmol L -1 Primer XCR 1.25 μL, 10 mmol L -1 dNTPs 0.6μL, 8U·μL -1 Bst DNA polymerase 0.4 μL, steril...

Embodiment 3

[0092] Example 3: Detection of food samples suspected of being infected with Yersinia enterocolitica

[0093] The food samples were subjected to DNA extraction and amplification detection according to the method described in Example 1. The electrophoresis results showed that the bands were 108, 216, and 324 in size from small to large, increasing at a speed of 108 bp, indicating that the sample to be tested was affected by the small intestine Infection by Yersinia coli.

[0094] The primers, probes and kits of the present invention can also detect Yersinia enterocolitica on other samples.

[0095]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a RCA (rolling circle amplification) rapid detection primer and kit for Yersinia enterocolitica, wherein the sequence of a primer combined with the specificity of a probe is SEQ ID NO: 1; the sequence of a primer combined with a fragment amplified through taking the probe as a template is SEQ ID NO: 2; and the sequence of the probe is SEQ ID NO: 3. The kit provided by the invention is characterized in that a padlock probe is designed according to the conserved gene sequence of a to-be-detected bacterial strain so as to ensure the specificity of a detection method. According to the invention, an improved rolling circle amplification (RCA) technique is adopted, and the technique is strong in specificity, and has higher sensitivity than that of a PCR (polymerase chain reaction) detection method; meanwhile, the technique is simple, rapid, safe, pollution-free, and especially applicable to food detection mechanisms.

Description

technical field [0001] The invention belongs to the technical field of detection of pathogenic microorganisms, and in particular relates to a rolling circle amplification rapid detection primer and a kit for Yersinia enterocolitica, that is, the rolling circle constant temperature amplification (RCA) technology is used for rapid detection of bacterial samples. Detect the primers for their application. Background technique [0002] Yersinia enterocolitica is a pathogenic bacterium that causes acute gastroenteritis-type food poisoning and is a zoonosis. The incubation period is about 3-7 days after ingestion, and the course of the disease is generally 1-3 days, but some cases last for 5-14 days or longer. The main symptoms of Yersinia enterocolitica infection are fever, abdominal pain, diarrhea, vomiting, arthritis, sepsis, etc. The susceptible population of this bacterium is infants and young children, which often cause fever, abdominal pain and bloody diarrhea. And Yersin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 姜英辉王滨张健尼秀媚李正义唐静马维兴雷质文
Owner INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More