Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine CD28 receptor and coding gene and application thereof

A gene and receptor technology, applied in the field of porcine CD28 receptor, can solve the problem that the coding sequence and its protein function have not been reported.

Active Publication Date: 2014-05-07
CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Furthermore, only the predicted gene sequence information of the porcine CD28 receptor has been published, and its exact coding sequence and protein function have not been reported before.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine CD28 receptor and coding gene and application thereof
  • Porcine CD28 receptor and coding gene and application thereof
  • Porcine CD28 receptor and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Cloning of Example 1 CD28 Gene

[0029] The present invention is based on the relatively high similarity of human and pig gene sequence comparison results, designs primers according to human CD28 sequence, and uses Wuzhishan pig cDNA as a template to obtain a suspected sequence of pig CD28. The specific operation steps are:

[0030] (1) By comparing with the human CD28 gene sequence, find a gene segment with high similarity in the pig genome, and design primers accordingly (see Table 1: P1 and P2).

[0031] (2) Extraction of porcine peripheral blood mononuclear cells (PBMC) cDNA:

[0032] Aseptically take 20ml of heparin sodium anticoagulant blood from the anterior vena cava of a pig, dilute and mix it with equal volume of PBS, and slowly add it to an equal volume of porcine lymphocyte separation medium (Tianjin Haoxiang, China), with a horizontal rotor Centrifuge at 1800rpm for 20min. Afterwards, the lymphocyte layer under the plasma was aspirated to obtain PBMC. T...

Embodiment 2

[0042] Example 2 Effect of up-regulated expression of CD28 gene on T cell immune response in mouse model

[0043] The BALB / C mouse system was used as a model to detect the changes in cell function after the CD28 molecule was overexpressed. The specific operation steps are:

[0044] (1) Construction of plasmid pGEM4Z / mCD28 / A64: pGEM4Z (purchased from Promega) was used as the starting vector, according to David Boczkowski, Smita K.Nair, Jong-Hee Nam, et al., Induction of Tumor Immunity and Cytotoxic T Lymphocyte Responses Using Dendritic Cells Transfected with Messenger RNA Amplified from Tumor Cells, the method disclosed in 2000 constructed plasmid pGEM4Z / mCD28 / A64.

[0045] (2) Synthesis and purification of CD28 mRNA: The synthesis of CD28 mRNA follows the RiboMAX of Promega Company TM The instructions of Large Scale RNA Production Systems-T7 were used. After the CD28 mRNA was synthesized, the RNA was purified with the kit RNessy Mini Kit (Qiagen), and finally the RNA was ...

Embodiment 3

[0057] Example 3 Effect of up-regulated expression of porcine CD28 gene on porcine T cell immune response

[0058] Using the strategy provided by the present invention, the plasmid containing porcine CD28 gene is transfected into porcine peripheral blood mononuclear cells (PBMC, mainly comprising T lymphocytes), and the activation and cell activation of cells when it is stimulated by antigen (PRRSV) is detected at the cellular level. Factor secretion activity.

[0059] (1) Construction of eukaryotic expression vector pIRES-CD28HA. Design upstream primer: 5′(EcoRI) GAATTC ATGATCCTCGGGTTACTCCTGG 3' and downstream primer: 5' (BamHI) GGATCC TCAAGCAACGTCCGGAACGTCGTACGGGTAGG AGCGGTAGGCTGCAAAG 3′ (the shaded part is the HA tag sequence), using the cloning vector containing the CD28 gene as a template to amplify the porcine CD28 fragment. The reaction system and procedure are the same as Step 3 in Example 1. Both ends of the cloned fragment contain EcoRI and BamHI restriction si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a porcine CD28 receptor molecule. The molecule is 1) protein with an amino acid sequence shown as SEQ ID No.2, or 2) protein which is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown as SEQ ID No.2, has the same activity as the protein 1) and is derived from the protein 1). The invention also provides a coding gene of the molecule. The coding gene has a nucleotide sequence shown as SEQ ID No.1. The co-stimulation receptor CD28 is specifically and highly expressed in a T cell, the activation, proliferation and cell factor secretion activity of the T cell when the T cell is subjected to antigenic stimulation can be enhanced, the acquired immune response of a host is enhanced, and the immune effect of a vaccine is enhanced.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering, and in particular relates to a porcine CD28 receptor, a gene encoding it and an application thereof. Background technique [0002] China is a large pork production and consumption country. However, the severe epidemics of swine fever, reproductive and respiratory syndrome (PRRSV) and other diseases are the biggest difficulties faced by my country's pig industry. major issues that need to be addressed urgently. However, in recent years, pig diseases have generally presented multi-pathogen cross-infection, and the disease resistance of pigs and the control effect of vaccines have been significantly reduced. Therefore, to do a good job in epidemic prevention and control, it is necessary to find new strategies for vaccine development, or seek alternative or auxiliary approaches, such as breeding new breeds of pigs with disease resistance. However, most of the existing research results are d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/705C12N15/12C12N15/63C12N5/10C07K16/28A61K39/395A61P37/04C12N15/85A01K67/027
Inventor 索勋刘贤勇苏华荔赵新新黄骁舾
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com