Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene

A technology of gene coding and antimicrobial peptides, applied in the direction of antifungal agents, genetic engineering, plant genetic improvement, etc., can solve the problem of no research report on Bemisia tabaci defensin antimicrobial peptides, etc., and achieve the effect of fast and simple process.

Active Publication Date: 2012-07-18
ZHEJIANG UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] So far, there is no research report on the antimicrobial peptide of Bemisia tabaci defensin at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene
  • Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene
  • Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment example 1

[0038] Implementation case 1: cDNA clone of whitefly defensin antimicrobial peptide

[0039] 1.1, TRIzol method to extract total RNA

[0040] (1) Freeze a certain amount (about 200 Bemisia tabaci) for 1 minute, put it into a 1.5ml centrifuge tube, add 1ml TRIzol reagent, thoroughly grind and homogenate, and let stand at room temperature for 5 minutes.

[0041] (2) Add 0.2ml chloroform to the centrifuge tube, shake for 15s, transfer the mixture into a TIANGEN centrifuge tube, and let stand for 2min.

[0042] (3) Centrifuge at 12000g for 15min at 4°C, take the supernatant, and transfer it to a new 1.5ml centrifuge tube.

[0043] (4) Add 0.5ml of isopropanol to the centrifuge tube, mix the liquid in the tube gently, and let stand at room temperature for 10 minutes.

[0044] (5) Centrifuge at 12000 g for 10 min at 4°C, and discard the supernatant.

[0045] (6) Add 1ml of 75% ethanol to the centrifuge tube, gently wash the precipitate, centrifuge at 7500g for 5min at 4°C, and di...

Embodiment 2

[0062] Example 2: Construction, expression and antibacterial function determination of recombinant expression vector of whitefly antibacterial peptide

[0063] 2.1 Expression vector construction

[0064] (1) According to the sequence of the whitefly defensin antibacterial peptide and the cloning site of the expression vector pET-32a (Novagen Company), primers were designed, and the 5'-end of the gene was designed to encode the recognition and cleavage site (IEGR) of factor Xa sequence:

[0065] Def-F: CG GGATCC ATTGAGGGTCGCGACGTCCTCATCGGAAGTT (underlined BamH I site, bold Xa factor coding sequence);

[0066] Def-R: CCG CTCGAG TTATTTACGGGTTTCGCACCAAC (XhoI site is underlined).

[0067] (2) Gene amplification, cloning and recombinant plasmid screening

[0068] Using the whitefly dsDNA as a template, the PCR reaction was carried out with the above primers. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 15s, 63°C, 30s, 72°C, 45s, 35 cycles; 72°C, 6min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to antimicrobial peptide and application thereof, and aims to provide a defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), the antimicrobial peptide encoded by the defensin gene and a preparation method for the defensin gene. A nucleotide sequence of the gene of the antimicrobial peptide is shown as SEQ ID NO.1; and an amino acid of the antimicrobial peptide is shown as SEQ ID NO.2. A protease Xa factor is introduced into an expression vector, so that recombinant fusion protein can be effectively digested, and defensin polypeptide is obtained through rapid separation in an ultrafiltration mode according to the magnitude of protein molecules; the whole process is quick and simple; and the obtained antimicrobial peptide has antifungal activity, and can remarkably inhibit the growth of entomopathogenic fungi such as Beauveria bassiana, Metarhizium anisopliae, Botrytis cinerea and the like.

Description

technical field [0001] The invention relates to a whitefly antibacterial peptide defensin gene, an antibacterial peptide encoded by it and application thereof. In particular, it relates to a method for purifying and preparing the recombinant whitefly antibacterial peptide defensin, the recombinant whitefly antibacterial peptide and its antibacterial application. Background technique [0002] In recent years, the whitefly Bemisia tabaci (Gennadius) has become a worldwide invasive and disastrous insect, breaking out into disasters all over the world, causing heavy losses. The insect not only eats a large amount of plant juice, causing the plants to wither, but also spreads a variety of plant viruses, especially geminiviruses, which often lead to the spread of plant virus diseases and cause severe crop yield reduction or failure. Bemisia tabaci has a wide range of hosts, strong fecundity, many ways of harm, and a particularly strong ability to develop resistance to insecticide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/70C07K14/435A61K38/17A61P31/10
Inventor 陈学新王知知时敏
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap