Method for producing glutathione by fermentation of recombinant Escherichia coli

A technology for recombining Escherichia coli and glutathione, which is applied in the field of bioengineering, can solve the problems of long production cycle and low production level per unit cell, achieve high GSH synthesis ability, short cell culture time and production cycle, and respond fast effect

Active Publication Date: 2012-07-18
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The production cycle of the above production methods is long, and the production level per unit bacterium is still on the low side, so it is necessary to further increase the production intensity and the production level per unit bacterium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing glutathione by fermentation of recombinant Escherichia coli
  • Method for producing glutathione by fermentation of recombinant Escherichia coli
  • Method for producing glutathione by fermentation of recombinant Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Gene cloning of bifunctional glutathione synthetase.

[0024] Streptococcus thermophilus genomic DNA was used as a template, and primers CGGCGAATTCACGATGACATTAAACCA and GGCAAGCTTTTAAGTTTGACCAGCCACT were used for PCR amplification to obtain a DNA fragment with a length of about 2.3kb (the gene sequence number is GU138096). Electrophoresis of PCR products as shown in figure 1 shown.

Embodiment 2

[0025] Example 2: Construction of recombinant Escherichia coli expressing exogenous bifunctional glutathione synthetase.

[0026] The gshF gene fragment amplified by PCR in Example 1 and the expression vector pTrc99A were digested overnight at 37°C with restriction endonucleases EcoRI and Hind III, and the target band was recovered by electrophoresis. The ligation reaction was carried out at ℃ for 12 hours to obtain the pTrc99A-gshF plasmid. And transform Escherichia coli JM109 to obtain recombinant Escherichia coli JM109 / pTrc99A-gshF ( figure 2 ).

[0027] Plasmid pTrc99A-gshF and plasmid pET28a were digested with EcoRI and Hind III overnight at 37°C, recovered by electrophoresis, and the digested target fragment gshF was ligated with the vector fragment pET28a, overnight at 16°C to obtain pET28a-gshF. The recombinant plasmid pET28a-gshF was transformed into Escherichia coli BL21 to obtain recombinant Escherichia coli BL21 / pET28a-gshF ( image 3 ).

Embodiment 3

[0028] Example 3: Fermentation of self-inducing medium.

[0029] The strain used is BL21 / pET28a-gshF, constructed by the method described in Example 2. Inoculate the overnight cultured seed culture medium with 5% inoculum into 3L compound medium (peptone 10 g / L, yeast extract 5 g / L, 50 mM phosphate buffer pH 7.6, ammonium chloride 50 mM , sodium sulfate 5 mM, magnesium sulfate 2 mM, 0.2 mL trace elements, glycerol 20 g / L, glucose 0.6 g / L, α-lactose 2 g / L) in a 5L fermenter, the fermentation temperature was 30°C, and the Air flow and speed, maintain dissolved oxygen above 20%. Add ammonia water to control pH 7.0. When the cell OD is 30, add three kinds of amino acids and continue to cultivate for 2 hours. The glutathione content is 3.20 g / L, the unit cell production level is 240 mg / g dry cell, and the production intensity is 165 mg / L / h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing glutathione by fermentation of recombinant Escherichia coli. The method comprises the following stages of: (1) carrying out batch culture or fed-batch culture to obtain a great deal of recombinant Escherichia coli cells expressing exogenous bifunctional glutathione synthetase, wherein the bifunctional glutathione synthetase is protein which simultaneously has activities of gamma-glutamyl cysteine synthetase and glutathione synthetase; (2) carrying out over-expression on the bifunctional glutathione synthetase obtained in the stage (1); and (3) adding L-glutamic acid, L-cysteine and glycine precursor amino acids to realize high-efficiency production of glutathione by fermentation. According to the invention, the recombinant Escherichia coli strain expressing the exogenous bifunctional glutathione synthetase is used for producing glutathione by fermentation, so that the method not only has high GSH (Glutathione) synthesizing capability, but also is free from GSH feedback inhibition, and has the advantages of rapid reaction, high glutathione yield and short production period.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a method for efficiently producing glutathione by recombinant Escherichia coli. Background technique [0002] Glutathione (GSH) is a tripeptide composed of L-glutamic acid, L-cysteine ​​and glycine with important physiological functions. Glutathione is widely distributed in animals, plants, and microorganisms, and participates in the synthesis of proteins and ribonucleic acids, the transport of oxygen and nutrients, the maintenance of endogenous enzyme activity, the tricarboxylic acid cycle and sugar metabolism in the body, and the removal of excessive free energy in the body. Base etc. Clinically, glutathione is used for anti-radiation, anti-tumor, anti-oxidation poisoning, anti-aging and coordinating endocrine therapy. In addition, glutathione is also used as a food additive to extend the shelf life of food and strengthen the amino acid composition in food. [0003] The main pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P21/02C12R1/19
Inventor李志敏叶勤李娓张松
OwnerEAST CHINA UNIV OF SCI & TECH