Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of protein ATCTPA2 related to photosynthesis

A protein and protein technology, applied in the biological field, can solve problems such as the absence of Arabidopsis CtpA enzyme reports

Inactive Publication Date: 2012-08-01
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The enzyme has been successfully cloned in higher plants such as spinach and soybean, but so far there has been no report on the true CtpA enzyme in Arabidopsis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein ATCTPA2 related to photosynthesis
  • Application of protein ATCTPA2 related to photosynthesis
  • Application of protein ATCTPA2 related to photosynthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Discovery process of gene function

[0042] 1. Identification of mutant materials

[0043] The mutant homozygote (salk_056011) of the T-DNA insertion of the nuclear coding gene At4g17740 located in the chloroplast was purchased from ABRC (Arabidopsis Biological Resource Center) in the United States. The gene encoding CtpA was named AtctpA2, and the encoded protein was named ATCTPA2.

[0044] T-DNA insertion mutant homozygotes and wild-type Arabidopsis (ordered from ABRC library, Col-0 type) were grown on MS medium with a growth light intensity of 40 ± 5 μmol m -2 ·s -1 , the result is figure 1 As shown, wild-type Arabidopsis thaliana (WT) on the left and mutant homozygotes with T-DNA insertion (AtctpA2) on the right, it was found that the cotyledons of the mutant homozygotes with T-DNA insertion were yellowed compared to wild-type Arabidopsis thaliana , true leaves light green, plant dwarf.

[0045] Two weeks later, the mutant homozygotes with T-DNA ins...

Embodiment 2

[0061] Example 2. Transgenic complementation experiment

[0062] 1. Acquisition of atctpa2 gene

[0063] The nucleotide sequence of the atctpa2 gene is sequence 1 in the sequence table. The primers were designed according to the sequence between 1 and 1545bp, and were expanded from the genome of Arabidopsis thaliana (Col-0 ecotype, purchased from the Arabidopsis Biological Resource Center). Gene. The primers used are as follows: Former: 5'CATG CCATGG AGGTCCTTGCGAGCT 3', Reverse: 5' GA AGATCT TCATCTAGAAAAAAGTAGGCCTTGA 3'. The amplified product was purified by cutting gel and then ligated to pEASY-T3 vector.

[0064] It was transformed into Escherichia coli DH5α, and positive clones were screened for PCR, restriction digestion and sequencing identification. The sequencing results show that its nucleotide sequence is the 1-1545th nucleotide from the 5' end of sequence 1 in the sequence listing, named atctpa2, which can encode the protein shown in sequence 2, and the protei...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a protein ATCTPA2 related to photosynthesis, and provides an application of the coding gene of the protein ATCTPA2 to protecting the photosynthesis of a plant photosystem II, wherein the protein ATCTPA2 is a protein I which is composed of an amino acid sequence shown in a sequence 2 in the sequence table, or a protein II which is obtained by replacing the amino acid residue sequence in the sequence 2 in the sequence table with one or more amino acid residues, and / or eliminating and / or adding one or more amino acid residues, is provided with the same activity as the protein I, and is derived by the protein I. The experiment of the invention shows that the protein ATCTPA2 which is related to photosynthesis and is discovered from arabidopsis can recuperate etiolated seedling of an arabidopsis mutant with reduced ATCTPA2 expression into green seedling.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of a photosynthesis-related protein ATCTPA2. Background technique [0002] Photosynthesis is the process by which green plants, algae and photosynthetic bacteria use solar energy to convert carbon dioxide and water into energy-rich organic compounds. Chloroplasts are organelles in green plants and algae that carry out photosynthesis. The stroma and grana lamellae evolved from chloroplasts in higher plants are the main sites for photosynthesis. Four complexes for photosynthesis electron transfer, namely photosystem I, photosystem II, cytochrome b, are gathered on this type of lamella. 6 f and ATPase complex. Among these four complexes, photosystem II is the first complex in the electron transport chain, and in this complex, the core protein D1 encoded by the psbA gene that constitutes the complex is also a A very important protein that directly interacts with the r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/50C12N15/57A01H5/00
CPCY02P60/40Y02A40/22
Inventor 卢从明雷明温晓刚卢庆陶杨志攀杨辉霞丁顺华尹燕张爱红
Owner INST OF BOTANY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products