Yarrowia lipolytica genetic engineering strain with high production of gamma-decalactone, as well as preparation method and application thereof

A technology of genetically engineered bacteria and genetically engineered strains, applied in the field of Yarrowia lipolytica genetically engineered bacteria

Inactive Publication Date: 2012-09-19
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are still defects in the application of fusion PCR technology, such as the length of the fusion product generally does not exceed 4.0kb, the number of fragments to be fused generally does not exceed 3, and the specificity of the product is poor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yarrowia lipolytica genetic engineering strain with high production of gamma-decalactone, as well as preparation method and application thereof
  • Yarrowia lipolytica genetic engineering strain with high production of gamma-decalactone, as well as preparation method and application thereof
  • Yarrowia lipolytica genetic engineering strain with high production of gamma-decalactone, as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1. Construction of PCPP Knockout Module

[0017] 1. Extraction of total genomic DNA from wild-type Yarrowia lipolytica.

[0018] 2. Using SOE PCR technology to construct the PCPP knockout module.

[0019]The entire gene sequence of POX3 gene, CRF1 copper resistance gene and POX2 gene of Yarrowia lipolytica yeast was found out by NCBI's Entrez retrieval system, and according to the position of the CDS region and the sequence of the promoter and terminator, Primer premier 5.0 software was used Design its upstream primers and downstream primers.

[0020] Homologous sequence primers for the upper segment of the POX3 gene:

[0021] Upstream primer POX3-up-1: acaacaccttcacagagccacc

[0022] Downstream primer POX3-up-2: gaagacgagttgagacgaagactttcgcacccagttagtcgt

[0023] CRF1 gene primers:

[0024] Upstream primer CRF1-1: acgactactgggtgcgaaagtcttcgtctcaactcgtcttc

[0025] Downstream primers CRF1-2: agagccgagggagaataaacggcgaaattggcggttggtat

[0026] POX2 gene pri...

Embodiment 2

[0059] Example 2. Screening of PCPP transformants

[0060] 1. Screening of transformants

[0061] Due to the insertion of the CRF1 gene, the transformant can grow on a plate containing a higher concentration of copper ions, so that the transformant can be screened. The wild-type strain and the transformed strain were respectively cultured on plates with copper ion concentrations of 2mM, 4mM, 8mM, 10mM, 12mM, 14mM, and 16mM concentration gradients. When the concentration of copper ions in the medium reached 8mM, the growth ability of the wild-type strain was weakened, and the number of colonies decreased, but the number of colonies on the plate of the transformed strain did not change. When the copper ion concentration reaches above 12mM, the wild-type strain does not grow, but there are still colonies growing on the plate of the transformed strain.

[0062] 2. Molecular biological identification of possible transformants

[0063] Inoculate the single colony Tp-1----Tp-20 gr...

Embodiment 3

[0064] Growth ability and biotransformation ability determination of embodiment 3 transformants

[0065] 1. The growth ability of the transformant Tp-12 and the wild-type strain was tested.

[0066] The seeds of the transformant Tp-12 strain and the wild-type strain were inoculated into YEPD growth medium and castor oil medium respectively, and the composition of the castor oil medium was: 1% to 10% of castor oil, 0.1% to 1% of yeast powder, Peptone 0.1%~1%, MgSO 4 ·7H 2 O0.1%~1%, Na 2 HPO 4 0.1%~1%, KH 2 PO 4 0.01%~0.05%, Tween 80 0.1%~1%, pH 6.5-7.5. The culture conditions are: liquid volume 50mL / 250mL, shaker speed 180r / min, temperature 28°C. Samples were taken every 4 hours, the absorption wavelength at 600nm was measured by a visible light-spectrophotometer, and the relationship curve between absorbance and incubation time was drawn.

[0067] The growth curves of transformants Tp-12 and wild-type strains in YEPD and castor oil medium are as follows: image 3 As...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a yarrowia lipolytica genetic engineering strain, as well as a preparation method and an application thereof. The preparation method comprises the following steps of: selecting a POX3 gene in a chromosome of a wild strain as a target gene, knockouting the POX3 gene, simultaneously inserting POX2 and CRF1 genes into the chromosome to enable the chromosome to completely lose short-chain specific acyl-CoA oxidation ability (POX3 gene coding), and simultaneously performing multiple coping of the POX2 genes of coded long-chain specific acyl-CoA oxidase so as to greatly enhance the capability of producing gamma-decalactone of the obtained engineering strain. The labeled gene CRF1 is also derived from the initial strain, so that the biological safety is ensured. A converter Tp-12 is stable in heredity; and furthermore, as the degradation efficiency of the yield of the gamma-decalactone is not obvious during the fermentation process, the converter Tp-12 can be used for industrial continuous fermentation culture of the gamma-decalactone by utilizing castor oil.

Description

technical field [0001] The invention relates to a Yarrowia lipolytica genetically engineered bacterium with high yield of gamma-decalactone, and also relates to a construction method of the genetically engineered bacterium and its application in industrial fermentation. Background technique [0002] γ-decalactone (γ-decalactone, GDL), widely exists in fruits, meat products and daily food, it has a strong fruity aroma, peach aroma after dilution, is the key component of fruity aroma. Gamma-decalactone has been found in the aroma components of more than 120 kinds of foods. In ripe fruit, the content of γ-decalactone can reach 15 μg / kg, 89% of which are (R)-isomers. In 1969, gamma-decalactone was recognized as a safe food and drug additive by the US Food and Drug Administration. γ-decalactone is widely used in various floral, fruity, oriental, and sandalwood fragrances for its attractive aroma and low aroma threshold (only 0.08mg / kg in water). It can be used in food, tobacc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/10C12P17/04C12R1/645
Inventor宋焕禄郭艳琼丁永志杜闪冯春利
OwnerBEIJING TECHNOLOGY AND BUSINESS UNIVERSITY