Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof

A technology of xyn-cdbfv-m and xylanase, applied in the field of genetic engineering, can solve the problems of increased viscosity, increased volume of chyme, decreased effects of nutrients and endogenous enzymes in the digestive tract, etc. The effect of applying potential

Active Publication Date: 2012-10-31
WUHAN SUNHY BIOLOGICAL
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Non-starch Polysaccharides (NSPs) rich in feed are important anti-nutritional factors, and the anti-nutritional effect of xylan with a high content is mainly manifested as: xylan itself is difficult to be digested by monogastric animals, At the same time, combined with a large amount of water, the volume and viscosity of chyme in the digestive tract of feeding animals will increase, and the effect of nutrients and endogenous enzymes in the digestive tract will decrease, thereby hindering the digestion and absorption of nutrients, especially fat and protein, and reducing the utilization of feed Rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof
  • Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof
  • Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1. Rational Design of Mutations Related to Thermal Stability of Xylanase xyn-CDBFV

[0034] (1) Homologous modeling

[0035] The xyn-CDBFV catalytic domain of xylanase from the rumen fungus Neocallimastix patriciarum, homology modeling is based on the crystal structure of Bacillus subtillis B230 xylanase (PDB: 1IGO) as a template, through the SWISS-MODEL server The Model module is completed by means of homologous comparison modeling, and it is named xyn-NP.pdb, and the Deepview / Swiss-PdbViewer software is used for three-dimensional model browsing and analysis.

[0036] (2) Disulfide bond design and selection

[0037] The present invention utilizes the disulfide bond design software Disulfide by Design (version 1.20) to perform disulfide bond prediction analysis on xyn-NP.pdb. After analysis, there are 24 potential sites that can form disulfide bonds in the three-dimensional structure of xyn-NP.pdb. They are: 33 and 58; 43 and 47; 46 and 62; 51 and 209; 61 and...

Embodiment 2

[0044] Embodiment 2, the synthesis of xyn-CDBFV and xyn-CDBFV-m of xylanase catalytic domain gene

[0045] The catalytic domain genes xyn-CDBFV and xyn-CDBFV-m from the rumen fungus Neocallimastix patriciarum, according to the codon preference of Pichia pastoris (Zhao Xiang, 2000), without changing the amino acid sequence Sequence modification is performed below. During the transformation, sites in the form of GT...AG should be avoided, and the appearance of AT-rich sequences (such as ATTTA, AATAA, AATTAA, etc.) should be avoided as much as possible. These sequences are related to the stability of mRNA. Send the modified and designed gene sequence to Nanjing Jinruisi Company for whole gene synthesis.

Embodiment 3

[0046] Example 3, Construction of recombinant expression vectors pET-22b(+)-xyn-CDBFV and pET-22b(+)-xyn-CDBFV-m

[0047] According to the sequence design of the synthetic gene, the 5' end of the PCR primer contains the Nco I endonuclease site, and the 3' end contains the EcoR I endonuclease site. The primer sequences are as follows:

[0048] 5' end primer pET-xyn-F: GCAC CCATGG GACAATCCTTCTGTTCCAGCGC; 3' end primer pET-xyn-R: GCAC GAATTC TTAGTCACCGATGTAAACCTTTG; using the synthetic gene as a template, PCR amplification was performed with the above primers, and the amplified fragment was cloned into the vector pET-22b(+) to obtain the recombinant vector pET-22b(+)-xyn-CDBFV.

[0049] The construction of pET-22b(+)-xyn-CDBFV-m is the same as the above vector, and its primers are 5' end primers pET-xyn-m-F: GCAC CCATGG GACAATCCTTCTGTTCCAGCG; 3' end primer pET-xyn-m-R: GCAC GAATTC TTAGTCACCGATGTAAACCTT.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the filed of genetic engineering, and specifically relates to a xylanase xyn-CDBFV-m with modified thermal stability, a gene thereof, and an application thereof. The amino acid sequence of the xylanase is represented by SEQ ID NO.1. The invention aims at improving the thermal stability of the xylanase xyn-CDBFV of rumen fungi neocallimastix patriciarum, so that the xylanase can resist high temperature during a feestuff granulation process, and thereby the xylanase can be applied in feedstuffs. According to the invention, with a protein engineering approach, disulfide bond is introduced into an N terminal of the xylanase xyn-CDBFV; two relatively high regions of B-factor are eliminated; and salt bond is introduced into a molecular surface, so that a xylanase xyn-CDBFV-m with substantially improved thermal stability is obtained. According to the xylanase xyn-CDBFV-m provided by the invention, 56.7% of enzymatic activity is maintained after 4min of treatment under a temperature of 80 DEG C. Therefore, the xylanase can resist short high-temperature treatment during feedstuff granulation. The xylanase provided by the invention shows great application potential.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular, the invention relates to a thermostability-improved xylanase xyn-CDBFV-m and its gene, a recombinant vector containing the gene and application thereof. Background technique [0002] Xylan is a five-carbon sugar and an important structural polysaccharide in plant cells. Its content in plant cell walls is second only to cellulose, accounting for about 35% of the dry weight of cells. Xylan is an important component of hemicellulose, the second most abundant polysaccharide in nature after cellulose, accounting for almost one-third of the earth's renewable organic carbon content. Xylan also widely exists in feed raw materials, such as corn, wheat bran, rice bran, straw, soybean meal, etc. Non-starch Polysaccharides (NSPs) rich in feed are important anti-nutritional factors, and the anti-nutritional effect of xylan with a high content is mainly manifested as: xylan itself is difficul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19A23K1/165C12R1/84C12R1/865C12R1/78C12R1/645
Inventor詹志春张菁
OwnerWUHAN SUNHY BIOLOGICAL