Proteins related to hexose transport and their coding genes and applications
A gene and coding technology, which is applied to proteins related to hexose transport and its coding genes and application fields, can solve the problems of research and undiscovered monosaccharide transporter-related gene cloning and function, etc., to improve quality and yield Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1. Acquisition of cucumber hexose transport-related protein and its coding gene
[0038] Sow the seeds of cucumber variety Guonong No. 25 (Department of Vegetables, China Agricultural University) in a mixed substrate with peat, vermiculite and field soil (volume ratio 1:1:1), and wait until the plants grow to 3-5 leaves Time-fixed values were placed in the solar greenhouse, under routine management, and 6 samples of roots, stems, leaves, petioles, flowers, and fruits were taken after the plants bloomed and bear fruit, and total RNA was extracted respectively by the TRIzol method, and reverse transcriptase (M -MLV) was reverse transcribed to obtain the first strand of cDNA. Using these cDNAs as templates, PCR was designed based on a possible monosaccharide transporter cDNA sequence compared with the cucumber genome database of the Chinese Academy of Agricultural Sciences (http: / / cucumber.genomics.org.cn / page / cucumber / index.jsp) Primers 5'-ATGGCGGGAGGTGGATTTGTT...
Embodiment 2
[0040] Example 2. Verification and analysis of the transport function of cucumber hexose transporter CsHT1 in yeast
[0041] 1. Construction of recombinant expression vector pDR196-CsHT1
[0042] Using the pGEM-T:CsHT1 recombinant plasmid obtained in Example 1 as a template, design primers, wherein the upstream primer is 5'-CCG GAATTC ATGGCGGGAGGTGGATTTGTTTCT (the dashed part is the EcoR I restriction site), the downstream primer is 5'-ACGC GTC GAC TCAGACACCTTTGCCATACGGCTCCATACT (the part underlined is the restriction site of Sal I), and the CsHT1 gene with restriction sites EcoR I and Sal I in the upstream and downstream were amplified by PCR. Then the above-mentioned amplified CsHT1 gene fragment, together with pDR196 (Ren-Chun Fan, Chang-Cao Peng et al (2009) Apple SucroseTransporter SUT 1and S orbitol TransporterSOT6 Interact with Cytochrome b5 to Regulate Their Affinity for Substrate Sugars.PlantPhysiol.Vol .150) the vector was digested with the same restriction endon...
Embodiment 3
[0072] Embodiment 3, expression analysis of CsHT1 gene in different tissues of cucumber
[0073] At noon on a sunny day, the roots, stems, leaves, petioles, flowers, and fruits of cucumber Guonong No. 25 that had grown to the early melon stage were selected, and the total RNA was extracted by the TRIzol method, and the RNA was detected by 1% agarose gel electrophoresis. integrity. Using the total RNA of the above-mentioned roots, stems, leaves, petioles, flowers, and fruits as templates, reverse transcribe to obtain the first cDNA strand, and use the cDNA strand as a template to perform PCR amplification with the following two primers:
[0074] 5'-ATGGCGGGAGGTGGATTTGTTTC and
[0075] 5'-TCAGACACCTTTGCCATACGGTCTCATACT-3', and 18s rRNA was used as an internal control for expression analysis.
[0076] The result is as figure 1 As shown, this result indicated that the CsHT1 gene could only be detected in cucumber flowers.
[0077]
[0078]
[0079]
[0080]
[00...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 