Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein

A technology for porcine circovirus and respiratory syndrome, which is applied in the field of veterinary medicine, can solve the problems of low protection rate and unsatisfactory vaccine immunization effect, and achieve the effect of stable nature.

Inactive Publication Date: 2013-04-24
CHONGQING ACAD OF ANIMAL SCI
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In actual production, direct economic losses caused by the infection of these two diseases lead to unsatisfactory immune effects of other vaccines, low protection rates, and stress reactions, as high as tens of millions of RMB per year, and indirect losses of hundreds of millions of RMB

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein
  • Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein
  • Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] 1. Modification and synthesis of nucleic acid sequences

[0042] Two antigen epitopes were selected through the nucleotide sequences of PCV2 and PRRSV published by GeneBank, and the two antigens were linked together by a flexible Linker. The target nucleotide sequence is as follows:

[0043] PCV2 nucleotide sequence fragment, as shown in SEQ ID NO: 1:

[0044] GGCATCTTCAACACCCGCCTCTCCCGCACCTTCGGATATACTATCAAGCGAACCACAGTCAAAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTGGGCTCCAGTGCTGTTATTCTAGATGATAACTTTGTAACAAAG GCCACAGCCCTGACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCCCCAAACCTGTCCTAGATTCCACTATTGATTACTTCCAACCGAACAACAAAAGAAATCAGCTGTGGCTGAGACTACAAACTGCTGGAAATGTAGACCACGTAGGCCTCGGCACTGCGTTCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTGAACCCT

[0045] PRRSV nucleotide sequence fragment,...

Embodiment 2

[0058] The purified recombinant protein was emulsified with Freund's adjuvant, specifically, the recombinant protein with a concentration of 80 μg / mL was mixed with an emulsifier at a ratio of 1:1 by volume and then emulsified. The product after emulsification is immunized with PRRSV and PCV2 antigen, and antibody test is negative 21 days old piglets, and inoculation dose is 80mg / head; Piglets were immunized as a control; 1 week, 2 weeks, 3 weeks and 4 weeks after immunization, the piglets were subjected to venous blood collection respectively, and the serum was separated; commercially available ELISA kits were used to detect the antibody OD values ​​of PRRSV and PCV2 in the serum (see Table 1 , Table 2), it was found that both PCV2 and PRRSV antibodies were positive after two weeks of immunization, and the PCV2 antibody was strongly positive.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of veterinary medicine, in particular to an animal recombinant protein vaccine. A recombinant protein contains an epitope of an antigen to a porcine circovirus (PCV) and an epitope of an antigen to a porcine reproductive and respiratory syndrome virus (PRRSV), and supports the vaccine after being emulsified. According to the recombinant protein, a target fragment shown as SEQ ID NO:6 is synthesized, the target fragment and a PGEX-4T-1 vector form a recombinant vector, a recombinant plasmid is converted into a host bacterium induced expression, and the recombinant protein is extracted. The recombinant protein content for swine immunization is a product of 4-hour host bacterium induced expression, and the recombinant protein at concentration of over 80 percent is purified by processes of inclusion body recovery, dissolution, concentration and the like. The prepared recombinant protein has a stable property, does not have the characteristics of virus transmission and the like, and is greatly advanced or plays an irreplaceable role in the researches and development of PRRSV and PCV2 prevention and control vaccines.

Description

technical field [0001] The invention relates to the field of animal medicine, in particular to animal recombinant vaccines. Background technique [0002] In addition to the direct harm of immunosuppressive diseases, the more important thing is to cause immunosuppression, which can cause low-pathogenic pathogens to cause a variety of disease syndromes, even to the extent that it is difficult to control, and cause reactions to vaccination. Enhanced, increased side effects, or immune failure and unresponsiveness to treatment. The harm of immunosuppressive venereal diseases is an increasing threat to the health of livestock and poultry. The most common and serious porcine immunosuppressive diseases are porcine reproductive and respiratory syndrome and circovirus type II infection. [0003] Porcine reproductive and respiratory syndrome (PRRS), caused by porcine reproductive and respiratory syndrome virus (PRRSV), is characterized by severe reproductive disorders such as abortio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63A61K39/295A61P31/14A61P31/20
Inventor 付利芝杨睿周雪沈克飞杨柳翟少钦张素辉王可甜
Owner CHONGQING ACAD OF ANIMAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap