Unlock instant, AI-driven research and patent intelligence for your innovation.

Targeting vector for knockout of bovine MSTN gene and application thereof

A technology for targeting vectors and genes, which is applied in the fields of molecular biology and biology to simplify the screening work

Active Publication Date: 2013-05-08
INNER MONGOLIA UNIVERSITY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are relatively few reports on the birth of animals, and the use of promoter-trapping vectors to carry out MSTN gene mutations is even rarer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting vector for knockout of bovine MSTN gene and application thereof
  • Targeting vector for knockout of bovine MSTN gene and application thereof
  • Targeting vector for knockout of bovine MSTN gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The extraction of embodiment 1 bovine ear tissue genomic DNA

[0037] Weighed 500 mg of ear tissue from Wagyu cattle (from Siziwangqi Ranch in Inner Mongolia Autonomous Region) stored in -80°C ultra-low temperature freezer, and used Promega’s The Genomic DNA Purification Kit was used to extract genomic DNA from Wagyu ear tissue according to the DNA extraction method of rat tail tissue, and finally the DNA was redissolved in 100 μL sterile distilled water. Use an ultraviolet spectrophotometer to detect the concentration of the extracted DNA and the OD value at a wavelength of 340 nm, and take 1 μL for agarose gel electrophoresis to detect the integrity of the DNA. The results of electrophoresis showed that the complete Wagyu genomic DNA was extracted, see image 3 .

Embodiment 2

[0038] Example 2 Obtaining of MSTN gene homology arms pMD19-T-N5mstn and pMD19-T-N3mstn

[0039] According to the template sequence GenBank Accession No.NC_007300, the upstream and downstream primers ShortA (TTT AAGCTT TCATTTGATTAGACCTTGTGGCTCC) and ShortB (TTT AAGCTT GGTTTTAAAA TCAATACAATCTTTT), and the upper and lower primer LongA (GA TCCGCGG CATGGTAGTAGATCGCTGTGGGTGT) and LongB (AAT CCGCGG AGTAGAATGGTCTTGAATGGTTAGGA), the underlined part is the restriction site. The 5' and 3' homology arms of the MSTN gene of the promoter-trapping targeting vector were synthesized by PCR using the above-mentioned bovine ear tissue genomic DNA as a template.

[0040] All PCR reactions are 20 μL reaction system: 2 μL of upstream and downstream primers, 0.5 μL of template DNA, 2 μL of 10×Buffer, 25 mM MgCl 2 1.4 μL, 2.5 mM dNTPs 3 μL, EXTaq 0.2 μL, sterilized ddH 2 O 8.9 μL.

[0041] PCR reaction conditions for the 5' homology arm: denaturation at 95°C for 50 s, annealing at 60°C for...

Embodiment 3

[0043] Example 3 Enzyme digestion identification and sequencing analysis of the 5' homology arm pMD19-T-N5mstn

[0044] Take 1 μL of the 5' homology arm pMD19-T-N5mstn plasmid, and use restriction endonucleases HindIII and Bgl II to carry out enzyme digestion and identification, and their restriction sites are located at both ends and inside of the 5' homology arm, respectively. Preliminary detection of the correctness of the 5' homology arm obtained by PCR. All enzyme digestion systems are 10 μL: 1 μL of 5’ homology arm pMD19-T-N5mstn plasmid, 10×Buffer 1 μL, endonuclease 0.5 μL, sterilized ddH 2 O 7.5 μL. DNA sequencing analysis was carried out on the correct plasmid identified by enzyme digestion, and the results showed that the homology of the 5' homology arm with the bovine MSTN gene sequence reported by GenBank was 96%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter trapping type targeting vector PIII-MSTN for knockout of a bovine myostatin MSTN gene. The vector can knock all of a first exon and a second exon and most of a third exon of the bovine MSTN gene; a knockout nucleotide sequence is shown as a SEQ ID NO:1; a PIII MSTN nucleotide sequence is shown as a SEQ ID NO:3, and contains homologous arm sequences about 1.3kb long and 6.8kb long of the bovine MSTN gene, a green fluorescent protein gene EGFP without promoter and a neomycin resistance gene Neor expression framework with promoter PGK. The promoter trapping type targeting vector PIII-MSTN provided by the invention can be used for the cultivation of transgenic beef cattle with MSTN gene knocked out.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, and relates to a promoter-capturing targeting vector, in particular to a promoter-capturing targeting vector for knocking out bovine MSTN gene and its application. Background technique [0002] Myostatin (MSTN) is a specific negative regulator of skeletal muscle growth and development. The loss or reduction of its activity will cause excessive muscle development in animals. The natural mutation of bovine MSTN gene will cause the "double muscle" phenomenon. Compared with normal cattle, double-muscle cattle have higher lean meat percentage and better meat quality, with low fat content and good taste, but there is a lack of "double-muscle" phenotype cattle in the existing breeds in China. The MSTN gene mutation homozygous mice were constructed by gene knockout technology, and it was found and verified that the body weight of somatostatin gene mutant mice was 30% larger than that o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/11C12N15/66C12N15/65C12N15/09A01K67/027
Inventor 李荣凤赵丽华李雪玲梁浩云亭
Owner INNER MONGOLIA UNIVERSITY