Proline-rich protein gene as well as expression vector and application thereof
A technology for proline protein and expression vector, which is applied in the field of proline-rich protein gene and its expression vector, can solve the problems of crop yield reduction, crop disease, decline, etc. resistance effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Cloning of a proline-rich protein gene in ear tissue induced by Gibberella in Wangshuibai
[0028] Wheat local variety Wangshuibai is currently recognized as a variety with the best resistance to scab, the most stable resistance, and a low DON content (Qi Zengjun, Pei Ziyou, etc. using DON test-HPLC to detect differences in DON content of wheat Fusarium toxin , 2005, 28(3):6-10). In the previous research, our laboratory used fast-neutron radiation to screen the acquired scab mutant NAUH117 (Jin Xiao, Xinping Jia et al. A Fast-neutron Induced Fragment Deletion of 3BS in wheat variety Wangshuibai Increased Its Susceptibility to Fusarium Head Blight, Chromosome Research, 2011-2-18, 19:225-234), the mutant had a chromosome deletion in a part of the 3BS region, and the missing fragment happened to be the main QTL for resistance to scab in Wangshuibai area. In order to obtain genes related to scab resistance in Wangshuibai, the present invention uses the Affymetri...
Embodiment 2
[0030] Chromosomal location of embodiment 2Ta-PRP3 gene
[0031] Specific primers PRP10F (AGTGCTACTCCACCTGCAT, SEQ ID NO.5) and ZW-3R (TTAGAGCTGATGGATCTATAG, SEQ ID NO.6) were designed according to the Ta-PRP3 gene sequence. The pair of primers only amplified a single band in Chinese spring. Taking a set of common wheat varieties Zhongguochun as aneuploidy-tetrasomies (E.R.Sears, Chen Peidu, Weng Yiqun. History of Chinese spring aneuploidy, Journal of Wheat Crops, 1990, 2: 16-19; Endo Takashi et al. Common Breeding of Wheat Chromosomal Deletion System, 1995, 2: 5-8. The deletion / tetrasome material used in the present invention was quoted from the genome of Wheat Genetics Resource Center, Kansas State University, USA) DNA was used as a template for PCR amplification reaction, and the chromosome physical location of TaPRP3 gene was carried out. PCR program: 10-50ng / μl DNA template, 0.5μl each of 10μM PRP10F and ZW-3R; 2.5μl 10×buffer; 2.5μl 2.5mM dNTP; 1.5μl 25mM Mg 2+ ; 0.25...
Embodiment 3
[0032] Embodiment 3Ta-PRP3 gene is subjected to the expression characteristic of Gibberella induction
[0033] The primer pair PRP-3D-2F (TCCAAGTGAACACGCGATAT, SEQ ID NO.7) and ZW-3R, which can specifically amplify Ta-PRP3, were used for real-time quantitative PCR (QRT-PCR) analysis of the gene induced by Gibberella. The PCR reaction was amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad, USA) and the fluorescence was detected. The 20 μl PCR reaction system contained 10 μl of 2×SYBR Green PCR Master Mix, 0.5uM primers PRP-3D-2F and ZW-3R, and 2 μl of reverse transcription cDNA template (the first strand of cDNA was synthesized as follows, and all reagents used were purchased from Takara Company. Add 1 μg total RNA and 2 μl Oligo d(T)18primers (100 nmol / mL) to a 200 μl eppendorf centrifuge tube, make up the volume of the solution to 10 μl with RNase-free sterile water; Incubate at 70°C for 10 minutes, then quench on ice for 2 minutes, and collect b...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com