Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Proline-rich protein gene as well as expression vector and application thereof

A technology for proline protein and expression vector, which is applied in the field of proline-rich protein gene and its expression vector, can solve the problems of crop yield reduction, crop disease, decline, etc. resistance effect

Inactive Publication Date: 2013-06-12
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the one hand, it can cause crop diseases, directly resulting in crop yield and quality decline; Pollution, poisonous to humans and animals if ingested

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Proline-rich protein gene as well as expression vector and application thereof
  • Proline-rich protein gene as well as expression vector and application thereof
  • Proline-rich protein gene as well as expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Cloning of a proline-rich protein gene in ear tissue induced by Gibberella in Wangshuibai

[0028] Wheat local variety Wangshuibai is currently recognized as a variety with the best resistance to scab, the most stable resistance, and a low DON content (Qi Zengjun, Pei Ziyou, etc. using DON test-HPLC to detect differences in DON content of wheat Fusarium toxin , 2005, 28(3):6-10). In the previous research, our laboratory used fast-neutron radiation to screen the acquired scab mutant NAUH117 (Jin Xiao, Xinping Jia et al. A Fast-neutron Induced Fragment Deletion of 3BS in wheat variety Wangshuibai Increased Its Susceptibility to Fusarium Head Blight, Chromosome Research, 2011-2-18, 19:225-234), the mutant had a chromosome deletion in a part of the 3BS region, and the missing fragment happened to be the main QTL for resistance to scab in Wangshuibai area. In order to obtain genes related to scab resistance in Wangshuibai, the present invention uses the Affymetri...

Embodiment 2

[0030] Chromosomal location of embodiment 2Ta-PRP3 gene

[0031] Specific primers PRP10F (AGTGCTACTCCACCTGCAT, SEQ ID NO.5) and ZW-3R (TTAGAGCTGATGGATCTATAG, SEQ ID NO.6) were designed according to the Ta-PRP3 gene sequence. The pair of primers only amplified a single band in Chinese spring. Taking a set of common wheat varieties Zhongguochun as aneuploidy-tetrasomies (E.R.Sears, Chen Peidu, Weng Yiqun. History of Chinese spring aneuploidy, Journal of Wheat Crops, 1990, 2: 16-19; Endo Takashi et al. Common Breeding of Wheat Chromosomal Deletion System, 1995, 2: 5-8. The deletion / tetrasome material used in the present invention was quoted from the genome of Wheat Genetics Resource Center, Kansas State University, USA) DNA was used as a template for PCR amplification reaction, and the chromosome physical location of TaPRP3 gene was carried out. PCR program: 10-50ng / μl DNA template, 0.5μl each of 10μM PRP10F and ZW-3R; 2.5μl 10×buffer; 2.5μl 2.5mM dNTP; 1.5μl 25mM Mg 2+ ; 0.25...

Embodiment 3

[0032] Embodiment 3Ta-PRP3 gene is subjected to the expression characteristic of Gibberella induction

[0033] The primer pair PRP-3D-2F (TCCAAGTGAACACGCGATAT, SEQ ID NO.7) and ZW-3R, which can specifically amplify Ta-PRP3, were used for real-time quantitative PCR (QRT-PCR) analysis of the gene induced by Gibberella. The PCR reaction was amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad, USA) and the fluorescence was detected. The 20 μl PCR reaction system contained 10 μl of 2×SYBR Green PCR Master Mix, 0.5uM primers PRP-3D-2F and ZW-3R, and 2 μl of reverse transcription cDNA template (the first strand of cDNA was synthesized as follows, and all reagents used were purchased from Takara Company. Add 1 μg total RNA and 2 μl Oligo d(T)18primers (100 nmol / mL) to a 200 μl eppendorf centrifuge tube, make up the volume of the solution to 10 μl with RNase-free sterile water; Incubate at 70°C for 10 minutes, then quench on ice for 2 minutes, and collect b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and discloses a proline-rich protein gene as well as an expression vector and application thereof. A cDNA (complementary Deoxyribonucleic Acid) sequence of Ta-PRP3 is SEQ ID NO.1, and an encoded amino acid sequence is SEQ ID No.2; the gene is from a common weat gibberellic disease resistant variety wnghuibai (Triticum Aestivumcv.Wanghuibai); the expression is enhanced in the wanghuibai due to the induction of gibberella; the gene transforms an infected wheat variety Yangmai 158 through particle bombardment; the result shows that the excessive expression of the Ta-PRP3 can be used for enhancing the resistance of the Yangmai 158 to the gibberellic disease, therefore the Ta-PRP3 is expected to be applied to the genetic engineering breeding; and the fusarium head blight resistance of the wheat is expected to be enhanced by introducing the Ta-PRP3 into the wheat varieties which are easily infected by the fusarium head blight.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a proline-rich protein gene in wheat, its expression vector and application. Background technique [0002] Wheat head blight (Fusarium head blight, FHB) is a fungal disease caused by Fusarium graminearum, which seriously damages wheat, barley and other small grains and corn and other crops. On the one hand, it can cause crop diseases, directly resulting in crop yield and quality decline; Pollution, human and animal ingestion can produce poison. In recent years, with global warming, adjustment of planting structure, and changes in farming systems and methods, the disease has spread rapidly in various wheat growing areas around the world, and controlling the occurrence and development of wheat scab has become a worldwide problem. [0003] Improving the resistance of wheat varieties, breeding and spreading disease-resistant varieties are the most economical, safe and effective ways ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/63C07K14/415A01H5/00
Inventor 王秀娥赵维萍肖进陈启广曹爱忠邢莉萍王海燕陈炜贾新平
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com