HIV type I protease inhibitor screened out from crude extract of Berberis nummularia Bge, and application thereof
A technology of AIDS virus and protease, which is applied in the direction of antiviral agents, microbe determination/inspection, medical preparations containing active ingredients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1: Expression, purification and crystal growth of HIV protease
[0059]The HIV-1 cDNA library (pNL4-3) was donated to the laboratory of Professor Gao Guangxia, Institute of Biophysics, Chinese Academy of Sciences. The gene fragment of HIV-1 Protease was obtained by polymerase chain reaction, and it was constructed on the pET-11a vector.
[0060] PCR upstream and downstream primers are:
[0061] 5'protease-11a-s ATCATATGGCCGATAGACAAGGAAC
[0062] 5'protease-11a-as GCGGATCCCTAAAAATTTAAAGTGC
[0063] Gene sequence of HIV-1protease:
[0064] GCCGATAGACAAGGAACTGTATCCTTTAGCTTCCCTCAGATCACTCTTTGGCAGCGACCCCTCGTCACAATAA
[0065] AGATAGGGGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGA
[0066] TGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAA
[0067] AAATGATAGGGGGAATTGGAGGTTTTATTCAAAGTAAGACAGTATGAT
[0068] CAGATACTCATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATT
[0069] AGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTC
[0070] AGATTGGTTGCACTTTAAATTTTTAG
[0071] Amino acid sequence...
Embodiment 2
[0088] Embodiment 2: the preparation of the alternative sample of barberry
[0089] Remove dead branches, dead leaves and other impurities from the whole Berberis chinensis herb, wash it, cut it into pieces, and dry it in a vacuum oven at 50°C for 12 hours. Accurately weigh 500 grams of dried and pulverized Berberis fructus, add 1000 mL of 95% ethanol to a 2500 mL round bottom flask, extract in a water bath at 80 °C for 4 hours, and filter while hot. Then, 1000 mL of 95% ethanol was added to the residue for a second extraction for 3 hours, and suction filtration was also performed while it was hot, and the filtrates were combined. Then, the combined filtrate was concentrated to about 20 mL, transferred to petri dishes for natural evaporation and drying at room temperature, and then transferred to a vacuum oven at 50° C. for drying for 24 hours to obtain extracts.
[0090] Weigh 20.5 grams of this extract, suspend it with 150 milliliters of double-distilled water, pour it into...
Embodiment 3
[0093] Example 3: Determination of HIV Protease Inhibitory Activity of Alternative Samples of Red Berberis
[0094] For the in vitro activity assay method of HIV-1 protease, refer to (Dieter Hoffmann et al., Journal of Clinical Virology 32 (2005) 294299), with appropriate improvements.
[0095] AIDS protease activity was assayed using the fluorescent substrate MCA-γ
[0096] -Abu-Ser-Gln-Asn-Tyr-Pro-Ile-Val-Gln--Lys(Dnp)-Lys-NH2 (purity greater than 95%, Shanghai Gil Biochemical Co., Ltd.) to complete. The amino acid sequence of the fluorescent substrate is derived from the specific cleavage sequence of HIV protease. The instrument used for the determination of fluorescence intensity was a Fluoraskan Ascent fluorimeter (ThermoLabsystems, Helsinki, Finland), and the wavelengths of excitation light and emission light were 320 nm and 405 nm, respectively.
[0097] The samples in the candidate library of natural product mixtures such as traditional Chinese medicines prepared acc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
