Plum blossom genetic map construction method
A construction method and genetic map technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as large differences in genetic basis, difficulty in sexual reproduction, complex origin of plum blossoms, etc., and achieve the goal of promoting the construction process Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Constructing a population intended for test crossing
[0020] The present embodiment selects the plum blossom variety 'Fenpetal' as the female parent, and its main characters are: 1-2 flower buds grow, mainly distributed in short flower branches and middle flower branches, extremely dense flowers, flower diameter 2.99cm (2.75-3.31cm), The flower buds are pink, with multiple colors at the top, 5-8 petals, shallow bowl-shaped single petals, pink, with color halo, full ovary, well-developed stigma, and high fruiting rate; 'Button Yudie' is the male parent, and its main characteristics are: 1-2 flower buds are born, mainly distributed in short flower branches and bunch flower branches, the flowers are relatively dense, the flower diameter is 2.32cm (1.6-2.68cm), the top of the flower buds has multiple colors, the petals are 14-16 pieces, double petals shallow bowl shape, White, full of anthers, large amount of loose powder, high viability of pollen.
[0021] Duri...
Embodiment 2
[0026] Embodiment 2 constructs genetic map
[0027] First, the F obtained in Example 1 1 Randomly select 260 F from the population to construct the genetic map 1 hybrid offspring. Take 1-3 young leaves below the top leaf, and extract the total DNA of the leaves with the Plant Genome Extraction Kit (DP305-02) of Tiangen Company, so that the DNA concentration reaches 50 ng / μl.
[0028] Furthermore, 1 μg of genomic DNA from each sample was completely digested at 37°C for 1 hour with 20 U of EcoRI restriction endonuclease (enzyme cutting site: 5'G^AATTC3') in a 50 μl system, and then at 65°C Incubate for 20 minutes to inactivate the endonuclease. Then use T4 DNA ligase (ENZYMATIC) to connect the Solexa P1 linker (P1 linker: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXTTAA-3′x with EcoRI cohesive end and different index (see Table 2) to each individual digestion product ), and incubate again at 65°C for 20 minutes to inactivate the ligase. Each of the 24 ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap