Plum blossom genetic map construction method

A construction method and genetic map technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as large differences in genetic basis, difficulty in sexual reproduction, complex origin of plum blossoms, etc., and achieve the goal of promoting the construction process Effect

Inactive Publication Date: 2013-07-03
BEIJING FORESTRY UNIVERSITY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the wide distribution of plum blossoms and rich resource variation, the genetic basis of plum blossoms in different ecological regions is quite different, and the origin of plum blossoms is complicated, and sexual reproduction is difficult. At present, there is no genetic map of plum blossoms, which seriously limits the development of plum blossoms. The development of molecular breeding work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plum blossom genetic map construction method
  • Plum blossom genetic map construction method
  • Plum blossom genetic map construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Constructing a population intended for test crossing

[0020] The present embodiment selects the plum blossom variety 'Fenpetal' as the female parent, and its main characters are: 1-2 flower buds grow, mainly distributed in short flower branches and middle flower branches, extremely dense flowers, flower diameter 2.99cm (2.75-3.31cm), The flower buds are pink, with multiple colors at the top, 5-8 petals, shallow bowl-shaped single petals, pink, with color halo, full ovary, well-developed stigma, and high fruiting rate; 'Button Yudie' is the male parent, and its main characteristics are: 1-2 flower buds are born, mainly distributed in short flower branches and bunch flower branches, the flowers are relatively dense, the flower diameter is 2.32cm (1.6-2.68cm), the top of the flower buds has multiple colors, the petals are 14-16 pieces, double petals shallow bowl shape, White, full of anthers, large amount of loose powder, high viability of pollen.

[0021] Duri...

Embodiment 2

[0026] Embodiment 2 constructs genetic map

[0027] First, the F obtained in Example 1 1 Randomly select 260 F from the population to construct the genetic map 1 hybrid offspring. Take 1-3 young leaves below the top leaf, and extract the total DNA of the leaves with the Plant Genome Extraction Kit (DP305-02) of Tiangen Company, so that the DNA concentration reaches 50 ng / μl.

[0028] Furthermore, 1 μg of genomic DNA from each sample was completely digested at 37°C for 1 hour with 20 U of EcoRI restriction endonuclease (enzyme cutting site: 5'G^AATTC3') in a 50 μl system, and then at 65°C Incubate for 20 minutes to inactivate the endonuclease. Then use T4 DNA ligase (ENZYMATIC) to connect the Solexa P1 linker (P1 linker: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXTTAA-3′x with EcoRI cohesive end and different index (see Table 2) to each individual digestion product ), and incubate again at 65°C for 20 minutes to inactivate the ligase. Each of the 24 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a plum blossom genetic map construction method comprising the steps that: (1) a plum blossom F1 generation testcross population is constructed; (2) parents and offspring genome DNA thereof are extracted; (3) with a DNA sequencing method related to restriction endonuclease loci, the parents and offspring genome are re-sequenced, such that a single-nucleotide polymorphism marker satisfying the Mendelian inheritance law is obtained; and (4) according to the obtained single-nucleotide polymorphism marker, the plum blossom genetic map is constructed by using a testcross strategy. According to the invention, plum blossom variety hybridization problems of low seed setting rate, long breeding cycle, and difficulty in constructing F1 population are overcome, and the plum blossom genetic map is rapidly constructed with an RAD and testcross strategy combined method.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a method for constructing a plum blossom genetic map. Background technique [0002] Plum blossom (Prunus mume Sieb.et Zucc.) is currently the only plant in China that has obtained the right to register international varieties. and Liu Xiaoxiang, 1997; Zhang Yongchun and Liu Xiaoxiang, 1999), reproductive physiology (Hu Jinliang and Xu Hanqing, 1994; Xu Hanqing and Wang Qingya, 1995; Zhao Shoubian and Liu Xiaoxiang, 1999) and other research fields have made considerable progress, but in molecular breeding lag. [0003] The construction of genetic map has important application value. The segregation population is the genetic material used to construct the genetic map, and the selection of the parents of the population directly affects the difficulty of constructing the genetic map and the scope of application of the map. Due to the long history of crop breedi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
Inventor 张启翔孙丽丹徐宗大张杰陈晶鑫
Owner BEIJING FORESTRY UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap