Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof

A technology of mitochondria and kit is applied in the detection kit and application field of mitochondrial T4353C mutation related to hypertension, which can solve problems such as trouble, and achieve the effects of alleviating pain, simple detection process and low cost.

Active Publication Date: 2015-01-28
ZHEJIANG UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This blood collection method has brought some pain and injury to many subjects, especially infants and young children, and there are certain risks and troubles when transferring samples across regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof
  • Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof
  • Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 A kit of the present invention

[0039] see figure 1 , the kit provided by the present invention consists of DNA extraction mixture 1, PCR mixture 2 for amplifying T4353C fragments, a pair of outer primers 3 designed for T4353C, inner primers 4 designed for T4353C, restriction endonucleases 5, positive Control 6, negative control 7 and box body 8, wherein DNA extraction mixture 1 is mainly composed of cell lysate and solution I, solution I contains proteinase K, chloroform, phenol, absolute alcohol; PCR for amplifying T4353C fragment Mixture 2 includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), outer primer 3 designed for T4353C has outer forward primer F: TGGCTCCTTTAACCTCTC CA (SEQ ID NO: 1) and outer reverse primer R: AAGGATTATGGATGCGGTTG (SEQ ID NO: 2); for T4353C designed A pair of inner primers 4 has inner forward primer F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTA GGACTATGAGAATCG AA...

Embodiment 2

[0041] Example 2 Carrying mitochondrial tRNA Ala Detection of essential hypertension families with T4353C mutation

[0042] 1. Test samples

[0043] see Figure 4 , A family with essential hypertension carrying the T4353C mutation was selected. This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 28, including 13 members of the maternal line, and 7 people suffering from high blood pressure.

[0044] 2. Extraction of Genomic DNA

[0045] Samples from 6 subjects were obtained respectively (including the collection of capillary and one drop of venous blood filter paper for II-2 and III-1; III-2 and III-6 for oral mucosa scraping or saliva; IV-1 and IV-2 For hair with hair follicles), use clean scissors to cut the blood filter paper into pieces of paper about 1cm2 in size, p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting mitochondrial DNA T4353C mutation linked to primary hypertension. The kit is composed of DNA extraction mixed liquor, PCR mixed liquor, outer primers and inner primers specifically designed for T4353C, restriction endonuclease, a positive control, a negative control and a kit body. According to the invention, genomic DNAs are rapidly extracted from samples like a small amount of a blood specimen, hair with hair follicles, a mouth mucosa scraping smear and saliva by using a protease K digestion cleavage process, so problems in extraction of DNAs from blood of a patient with primary hypertension in the prior art are overcome, pains of a detected person are alleviated, and trans-regional sample transmission is realized; different sites formed by the specific restriction endonuclease enable specificity of enzyme digestion to be improved; the phenomenon of false negative results is avoided, and stability of detection results is improved; and the kit has the advantages of low detection cost, simple and fast detection flow, visually interpretable results and good practicality.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a kit for detecting the mitochondrial DNA T4353C mutation associated with essential hypertension, and also relates to a detection method for the mitochondrial gene mutation associated with essential hypertension, in particular to the detection of mitochondria tRNA Gln The method for the T4353C mutation, and the application of the above-mentioned method or the above-mentioned kit in detecting the mitochondrial DNA T4353C mutation related to essential hypertension. Background technique [0002] Cardiovascular disease is the leading cause of death worldwide, including a series of diseases involving the circulatory system (mainly the heart and blood vessels) such as coronary heart disease, hypertension, heart attack, stroke, cardiomyopathy and heart failure. According to the statistics of the World Health Organization (WHO), about 17.3 million people died of cardiovascular disease...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 管敏鑫蒋萍萍冀延春肖云郑静梁敏毛卓超黄杨熠艺
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More