Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof
A technology of mitochondria and kit is applied in the detection kit and application field of mitochondrial T4353C mutation related to hypertension, which can solve problems such as trouble, and achieve the effects of alleviating pain, simple detection process and low cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 A kit of the present invention
[0039] see figure 1 , the kit provided by the present invention consists of DNA extraction mixture 1, PCR mixture 2 for amplifying T4353C fragments, a pair of outer primers 3 designed for T4353C, inner primers 4 designed for T4353C, restriction endonucleases 5, positive Control 6, negative control 7 and box body 8, wherein DNA extraction mixture 1 is mainly composed of cell lysate and solution I, solution I contains proteinase K, chloroform, phenol, absolute alcohol; PCR for amplifying T4353C fragment Mixture 2 includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), outer primer 3 designed for T4353C has outer forward primer F: TGGCTCCTTTAACCTCTC CA (SEQ ID NO: 1) and outer reverse primer R: AAGGATTATGGATGCGGTTG (SEQ ID NO: 2); for T4353C designed A pair of inner primers 4 has inner forward primer F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTA GGACTATGAGAATCG AA...
Embodiment 2
[0041] Example 2 Carrying mitochondrial tRNA Ala Detection of essential hypertension families with T4353C mutation
[0042] 1. Test samples
[0043] see Figure 4 , A family with essential hypertension carrying the T4353C mutation was selected. This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 28, including 13 members of the maternal line, and 7 people suffering from high blood pressure.
[0044] 2. Extraction of Genomic DNA
[0045] Samples from 6 subjects were obtained respectively (including the collection of capillary and one drop of venous blood filter paper for II-2 and III-1; III-2 and III-6 for oral mucosa scraping or saliva; IV-1 and IV-2 For hair with hair follicles), use clean scissors to cut the blood filter paper into pieces of paper about 1cm2 in size, p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap