Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein possessing excellent protecting effects against high-dose radiation and preparation method thereof

A fusion protein and high-dose technology, applied in the field of recombinant proteins, can solve the problems of high toxicity and side effects of radiation protection biological agents, and achieve good economic and social value.

Inactive Publication Date: 2013-10-02
许颖
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The present invention aims to solve many technical problems such as high toxicity and side effects of the existing radiation protection biological preparations, so as to provide a fusion protein capable of effectively protecting the body from large doses of radiation exposure damage, low toxicity and low side effects, and a preparation method thereof

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein possessing excellent protecting effects against high-dose radiation and preparation method thereof
  • Fusion protein possessing excellent protecting effects against high-dose radiation and preparation method thereof
  • Fusion protein possessing excellent protecting effects against high-dose radiation and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning and expression of FlaA N / C

[0039] 1) Synthetic gene sequence:

[0040] ATTAACACCAACGTGGCGAGCCTGACCGCGCAGCGTAACCTGGGCGTGAGCGGCAACATGATGCAGACCAGCATTCAGCGTCTGAGCAGCGGCCTGCGTATTAACAGCGCGAAAGATGATGCGGCGGGCCTGGCGATTAGCCAGCGTATGACCGCGCAGATTCGTGGCATGAACCAGGCGGTGCGTAACGCGAACGATGGCATTAGCCTGGCGCAGGTGGCGGAAGGCGCGATGCAGGAAACCACCAACATTCTGCAGCGTATGCGTGAACTGAGCGTGCAGGCGGCGAACAGCACCAACAACAGCAGCGATCGTAGCAGCATTCAGAGCGAAATTAGCCAGCTGAAAAGCGAACTGGAACGTATTGCGCAGAACACCGAATTTAACGGCCAGCGTATTCTGGATGGCAGCTTTAGCGGTGGTGGTGGTAGCGGCGGCGGCGGCAGCATTAAACGTATTGATGCGGCGCTGAACAGCGTGAACAGCAACCGTGCGAACATGGGCGCGCTGCAGAACCGTTTTGAAAGCACCATTGCGAACCTGCAGAACGTGAGCGATAACCTGAGCGCGGCGCGTAGCCGTATTCAGGATGCGGATTATGCGGCGGAAATGGCGAGCCTGACCAAAAACCAGATTCTGCAGCAGGCGGGCACCGCGATGCTGGCGCAGGCGAACAGCCTGCCGCAGAGCGTGCTGAGCCTGCTG

[0041] 2) Double enzyme digestion and cloning of the target gene into pUC57 for storage.

[0042] 3) Double digestion of pUC57-FlaA-N / C plasmid and pET30a plasmid and purification and recovery

...

Embodiment 2

[0053] Example 2 Purification of FlaA N / C Protein

[0054] Resuspend the precipitate obtained by ultrasonic centrifugation in 20-30 ml of 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min. Centrifuge at 12000 rpm for 10 minutes, and transfer the supernatant to another tube for storage. Resuspend the pellet in 20-30 ml 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min. Centrifuge at 12000 rpm for 10 minutes, and discard the supernatant. Repeat the steps: resuspend the pellet in 20-30 ml 10 mM Tris-HCl (pH 8.0) solution, let it stand for 10 min, centrifuge at 12000 rpm for 10 min, and discard the supernatant. First add a small amount of 10 mM Tris-HCl (pH 8.0) solution to resuspend the pellet, and then add 5-10 ml of 10 mM Tris-HCl (pH 8.0) solution containing 8 M urea to dissolve the protein. Centrifuge at 12000 rpm for 10 min, collect the supernatant, and take 50μl of electrophoresis (see image 3 ).

[0055] Protein renaturation

[0056] Dialysis Buffer (1...

Embodiment 3

[0057] Example 3 Cytokine stimulation test

[0058] There are 18 BABLc mice, 3 in each group. 1μg / g of FlaA N / C fusion protein was injected subcutaneously. After injection, blood was taken from the orbit at oh, 2h, 4h, 8h, 12h and 24h for testing, and each serum was in parallel Tested twice, using a cytokine kit to detect IL-6, IL-1-beta, TNF-α, TGF-β1 and IL-12 and other cytokines (operate according to the kit instructions), and the results show (see Figure 5 ), IL-6 level increased significantly, the peak value was about two hours after injection, and it could maintain a high level within 8 hours after injection, and it continued to return to normal at 24 hours without significant changes in other cytokine levels. The results of recent studies by KrivokrysenkoVI et al. (KrivokrysenkoVI, Shakhov AN, et al. J. Pharmacol. Exp. Ther. 2012, DOI:10.1124 / jpet.112.196071) showed that after CBLB502 stimulation, IL-6 levels are positively correlated with radiation protection effects . ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein possessing excellent protecting effects against high-dose radiation and a preparation method thereof, belongs to the field of recombinant protein technology, and aims to solve a great number of problems of existing radiation protection preparations that toxicity is strong, side effects are severe, and the like. The form of the amino acid sequence of the fusion protein possessing excellent protecting effects against high-dose radiation is N-Flexiblepeptide-C, wherein N represents N-terminal protein of legionella?pneumophilia flagellin, Flexiblepeptide represents a flexible peptide fragment, and C represents C-terminal protein of legionella?pneumophilia flagellin.

Description

Technical field [0001] The invention relates to the technical field of recombinant proteins, in particular to a fusion protein with high-efficiency biological protection against large-dose radiation and a preparation method thereof. [0002] Background technique [0003] At present, radiotherapy has become one of the most important methods of cancer treatment. About 70% of cancers in my country require radiotherapy. According to statistics in the United States, more than 50% of cancers require radiotherapy. For many cancer patients, radiotherapy It is the only necessary treatment method. High-dose radiation can destroy or destroy cancer cells, but it also damages normal cells and causes side effects. At the same time, acute high-dose radiation exposure to people caused by nuclear leaks or terrorist events often causes acute radiation syndrome, causing irreversible damage to various organs or tissues of the body, and current conventional treatment methods are still limited to antibi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/63C07K1/16A61K38/16A61P39/00A61P17/16A23L33/17
CPCY02A50/30
Inventor 许颖
Owner 许颖