Fusion protein possessing excellent protecting effects against high-dose radiation and preparation method thereof
A fusion protein and high-dose technology, applied in the field of recombinant proteins, can solve the problems of high toxicity and side effects of radiation protection biological agents, and achieve good economic and social value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Cloning and expression of FlaA N / C
[0039] 1) Synthetic gene sequence:
[0040] ATTAACACCAACGTGGCGAGCCTGACCGCGCAGCGTAACCTGGGCGTGAGCGGCAACATGATGCAGACCAGCATTCAGCGTCTGAGCAGCGGCCTGCGTATTAACAGCGCGAAAGATGATGCGGCGGGCCTGGCGATTAGCCAGCGTATGACCGCGCAGATTCGTGGCATGAACCAGGCGGTGCGTAACGCGAACGATGGCATTAGCCTGGCGCAGGTGGCGGAAGGCGCGATGCAGGAAACCACCAACATTCTGCAGCGTATGCGTGAACTGAGCGTGCAGGCGGCGAACAGCACCAACAACAGCAGCGATCGTAGCAGCATTCAGAGCGAAATTAGCCAGCTGAAAAGCGAACTGGAACGTATTGCGCAGAACACCGAATTTAACGGCCAGCGTATTCTGGATGGCAGCTTTAGCGGTGGTGGTGGTAGCGGCGGCGGCGGCAGCATTAAACGTATTGATGCGGCGCTGAACAGCGTGAACAGCAACCGTGCGAACATGGGCGCGCTGCAGAACCGTTTTGAAAGCACCATTGCGAACCTGCAGAACGTGAGCGATAACCTGAGCGCGGCGCGTAGCCGTATTCAGGATGCGGATTATGCGGCGGAAATGGCGAGCCTGACCAAAAACCAGATTCTGCAGCAGGCGGGCACCGCGATGCTGGCGCAGGCGAACAGCCTGCCGCAGAGCGTGCTGAGCCTGCTG
[0041] 2) Double enzyme digestion and cloning of the target gene into pUC57 for storage.
[0042] 3) Double digestion of pUC57-FlaA-N / C plasmid and pET30a plasmid and purification and recovery
...
Embodiment 2
[0053] Example 2 Purification of FlaA N / C Protein
[0054] Resuspend the precipitate obtained by ultrasonic centrifugation in 20-30 ml of 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min. Centrifuge at 12000 rpm for 10 minutes, and transfer the supernatant to another tube for storage. Resuspend the pellet in 20-30 ml 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min. Centrifuge at 12000 rpm for 10 minutes, and discard the supernatant. Repeat the steps: resuspend the pellet in 20-30 ml 10 mM Tris-HCl (pH 8.0) solution, let it stand for 10 min, centrifuge at 12000 rpm for 10 min, and discard the supernatant. First add a small amount of 10 mM Tris-HCl (pH 8.0) solution to resuspend the pellet, and then add 5-10 ml of 10 mM Tris-HCl (pH 8.0) solution containing 8 M urea to dissolve the protein. Centrifuge at 12000 rpm for 10 min, collect the supernatant, and take 50μl of electrophoresis (see image 3 ).
[0055] Protein renaturation
[0056] Dialysis Buffer (1...
Embodiment 3
[0057] Example 3 Cytokine stimulation test
[0058] There are 18 BABLc mice, 3 in each group. 1μg / g of FlaA N / C fusion protein was injected subcutaneously. After injection, blood was taken from the orbit at oh, 2h, 4h, 8h, 12h and 24h for testing, and each serum was in parallel Tested twice, using a cytokine kit to detect IL-6, IL-1-beta, TNF-α, TGF-β1 and IL-12 and other cytokines (operate according to the kit instructions), and the results show (see Figure 5 ), IL-6 level increased significantly, the peak value was about two hours after injection, and it could maintain a high level within 8 hours after injection, and it continued to return to normal at 24 hours without significant changes in other cytokine levels. The results of recent studies by KrivokrysenkoVI et al. (KrivokrysenkoVI, Shakhov AN, et al. J. Pharmacol. Exp. Ther. 2012, DOI:10.1124 / jpet.112.196071) showed that after CBLB502 stimulation, IL-6 levels are positively correlated with radiation protection effects . ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com