Inducible-expression shuttle expression tool vector for borrelia and construction method and application thereof
A technology of Borrelia and construction method, applied in the field of medical microbiology, can solve problems such as unfavorable research and development of Borrelia
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Synthesis of Partial Double Strands and Construction of Inducible Borrelia Shuttle Expression Tool Vector
[0044] Four single-stranded nucleotide DNA fragments (Invitrogen Company) were designed respectively, and the sequences were:
[0045] FLAG-HA-Tag1: TA TGGATTATAAAGATGATGATGATAAAGCCATGGCTGCAGA GCTC GTCGACCG;
[0046] FLAG-HA-Tag2: GAGCTCTGCAGCCATGGCTTTTATCATCATCATCTTTTATAATCC A ;
[0047] FLAG-HA-Tag3: CGGCGGCCGCCTCGAGTATCCTTATGATGTACCTGATTATGCT TA ;
[0048] FLAG-HA-Tag4: AGCT TAAGCATAATCAGGTACATCATAAGGATACTCGAGGCG GCCGCCG CGGTCGAC;
[0049] Among them, tag1 and tag2, tag3 and tag4 contain complementary sequences (underlined), the ends of tag1 and tag4 are complementary, and the 5' ends of tag1 and tag4 are phosphorylated.
[0050] Dissolve 4 synthetic DNA fragments (1 μg solid powder, Invitrogen, USA) to 50 μM in distilled water, mix in equal volumes, act at 95°C for 10 minutes, then gradually cool to 25°C and place for 12 hours to anneal and ge...
Embodiment 2
[0058] Construction of rpoS-induced expression strains
[0059] In order to verify that the constructed shuttle plasmid can replicate in Borrelia and has a controllable inducible expression element, this study selected the rpoS gene of Borrelia as an example, and used the constructed shuttle plasmid to induce the expression of rpoS gene in Borrelia. In Borrelia, the protein encoded by the rpoS gene, RpoS, is a sigma factor responsible for initiating the expression of the ospC gene, which encodes the membrane protein OspC, a virulence factor involved in Borrelia pathogenicity.
[0060] The rpoS gene of Borrelia B31 strain (GenBankID: 1195628) was amplified by PCR. The amplification primers were: upstream primer, GAGCTCCATATGAACATATTTAGTAATGAGG; downstream primer, AAGCTACTCGAGAT TTATTTCTTCTTTTAATTTTTAA. The amplification conditions are: 94°C for 5 minutes; 94°C for 25 seconds, 68°C for 1 minute, 30 cycles; 72°C for 10 minutes. After the PCR product was recovered from the gel, i...
Embodiment 3
[0063] Induced expression and functional verification of RpoS
[0064] Inoculate knockout bacteria ΔrpoS and strain ΔrpoS[pJJ275-RpoS HA ] into fresh BSK-H medium (Sigma, USA), cultivated to the logarithmic growth phase, counted by dark field microscope, and determined that the concentration reached 10 7 cell ml -1 , adding 1 mM IPTG and inducing at 37°C for 9 hours, while taking the sample without adding IPTG as a control. After induction, the cells were collected by centrifugation, a part was used for SDS-PAGE and Western blot analysis, and the other part was used for preparing RNA for reverse transcription and real time PCR analysis.
[0065] The method of real-time fluorescent quantitative PCR (Real time PCR, RT-PCR) is as follows, referring to the Qiagen RNA extraction kit (Qiagen, USA) instructions, take 10 Borrelia cells 8 Extract total RNA, remove residual DNA after DNAase treatment, and take 1g of RNA for reverse transcription. The reverse transcription method was...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap