Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate

A kind of aureus, reductase technology, applied in the production of aprepitant chiral intermediates, the field of new carbonyl reductase

Active Publication Date: 2014-01-08
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF2 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these reports all use whole cells of microbial strains as biocatalysts, and the concentration of transformable substrates is low. At present, only Leifsonia xyli HS0904 has a high concentration of substrates, and the highest concentration of transformable substrates is 51g / L. The conversion rate of 30h is 91.8% (J.Microbiol.Biotechnol.2013,23(3),343-350)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 2: the identification of screening bacterial strain

[0041] In order to confirm the taxonomic status of the strain and understand its performance in detail, the strain was initially identified. The colony of this strain is round and smooth, and with different culture time, the colony is light yellow to golden yellow.

[0042] 16S rRNA identification: Genomic DNA was used as a template, the 16S rRNA sequence was amplified with bacterial universal primers 27f and 1492r, and the PCR product was directly sent for sequencing. The obtained partial sequence (1381bp) was as follows (SEQ No.3):

Embodiment 2

[0043]AGCTGAGCGGTAGAGTTTCTTCGGAGACTTGAGAGCGGCGTACGGGTGCGGAACACGTGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATAGAGTGGCATCACTTTATATTGAAAACTGAGGTGGATAAAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCGATGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTTAGCGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTACAGGGATAAACCTATTTACGTGTAAATAGCTGAAGGTACTGTACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGAAATCTCACAGCTT AACTGTGAAACTGCCATTGATACTGCAGGTCTTGAGTAAGGTAGAAGTGGCTGGAATAAGTAGTGTAGCGGTGAAATGCATAGATATTACTTAGAACACCAATTGCGAAGGCAGGTCACTATGTCTTAACTGACGCTGATGGACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGCTAACTCGTTTTTGGGCTTTCGGGTTCAGAGACTAAGCGAAAGTGATAAGTTAGCCACCTGGGGAGTACGAACGCAAGTTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGATTATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCAAGGCTTAAATGGGAATTGATCGGTTTAGAAATAGACCTTCCTTCGGGCAATTTTCAAGGTGCTGCATGGTTGTCG...

Embodiment 3

[0048] (1) Take 0.5g of bacteria and resuspend in 10ml buffer, add substrate 3,5-bistrifluoromethyl acetophenone 10mg, and add 0.5ml of isopropanol (5%) and glucose 0.2g (2% ), 30°C, 230rpm conversion for 5h. Extract with 10ml ethyl acetate, take the organic phase gas chromatography (SGE, Australia, AC-5, 30m×0.22) to determine the conversion rate is 95.6%, and determine the gas phase chiral column (CHIRASIL-DEX CB, Varian 25m×0.25) The ee value of the product is greater than 99%.

[0049]

[0050] The product data is as follows:

[0051] colorless liquid, [α] D 25 =+21.6(c=1, acetonitrile);

[0052] ee>99% (CHIRASIL-DEX CB, column temperature: 120°C, injector: 260°C, detector: 280°C, t=8.403min);

[0053] 1H NMR (600MHz, CDCl 3 ):δ7.84(s,2H,Ar-H),7.78(s,1H,Ar-H),5.04(q,J=6.54Hz,1H,-CH),1.99(br,1H,OH), 1.55(d,J=6.54Hz,3H,-CH 3 )

[0054] (2) Take 1.0 g of bacteria and resuspend in 10 ml of buffer, add 100 mg of substrate, add the same amount of glucose and isopropa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of Chryseobacterium sp. CA49 (with an accession number of CCTCC M2012484), carbonyl reductase ChKRED20 coded by the genome of the strain and preparation of an aprepitant chiral intermediate (R)-1-[3,5-di(trifluoromethyl)phenyl]ethanol by using the original strain of Chryseobacterium sp. or the carbonyl reductase as a biocatalyst. The enantiomeric excess value of the produced intermediate is greater than 99.9%. Crude ChKRED20 enzyme powder can catalyze up to 200 g / L of a substrate and enables a conversion rate of more than 99% to be obtained in 24 h; a coenzyme circulating system is simple and cheap, the produced intermediate is easy to separate and purify, and a high recovery rate and good industrial application prospects are obtained.

Description

technical field [0001] The invention belongs to the field of applied microorganisms and enzyme engineering, and specifically relates to a strain of Chryseobacterium aureus and a novel carbonyl reductase encoded by its genome, and uses the bacteria or the carbonyl reductase as a biocatalyst to produce aprepitant chiral intermediate . Background technique [0002] Optically active (R)-1-[3,5-bis(trifluoromethyl)phenyl]ethanol is a key chiral intermediate of the drug Aprepitant (trade name "Emend") developed by Merk. The main function of aprepitant is to prevent and treat acute or delayed vomiting caused by chemotherapy. [0003] The current mainstream process for preparing the chiral intermediate is chemical synthesis. In recent years, with the continuous development of biocatalysis technology, researchers have actively explored the method of enzymatically catalyzing prochiral ketones to produce this intermediate, and screened some microbial strains with enantioselectivity &...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C12N15/53C12N9/04C12P7/22C12R1/01
Inventor吴中柳刘艳汤脱险裴小琼
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S