Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate

A kind of aureus, reductase technology, applied in the field of new carbonyl reductase, the production of aprepitant chiral intermediates, can solve the problem of low substrate concentration

Active Publication Date: 2015-03-25
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these reports all use whole cells of microbial strains as biocatalysts, and the concentration of transformable substrates is low. At present, only Leifsonia xyli HS0904 has a high concentration of substrates, and the highest concentration of transformable substrates is 51g / L. The conversion rate of 30h is 91.8% (J.Microbiol.Biotechnol.2013,23(3),343-350)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate
  • Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1: strain screening

[0038] Soil samples were collected in an orchard, and cultured at 30°C, 230rpm for 7-10 days with 3,5-bistrifluoromethylacetophenone (2g / L) as the sole carbon source and adding inorganic salts. The inorganic salt is: Na 2 HPO 4 2g / L, KH 2 PO 4 1g / L, NH 4 Cl0.4g / L, MgCl 2 0.4g / L. Take 1% of the enriched solution and add it to the same medium as above for further enrichment and culture for 7-10 days. The medium was then diluted 10 4 times, and spread on the screening plate (the above inorganic salt + 3,5-bistrifluoromethylacetophenone 1g / L + yeast powder 0.5g / L + agar powder 15g / L), culture at 30°C for 1-3 days, Many single colonies of microorganisms can be seen on each plate, and these strains are possible enzyme-producing strains.

[0039] The single colonies in the enrichment plate were inserted into each well of a 24-well screening plate (Costar, USA) one by one with a sterile toothpick for culture (each well was filled with 1...

Embodiment 2

[0040] Embodiment 2: the identification of screening bacterial strain

[0041] In order to confirm the taxonomic status of the strain and understand its performance in detail, the strain was initially identified. The colony of this strain is round and smooth, and with different culture time, the colony is light yellow to golden yellow.

[0042] 16S rRNA identification: Genomic DNA was used as a template, the 16S rRNA sequence was amplified with bacterial universal primers 27f and 1492r, and the PCR product was directly sent for sequencing. The obtained partial sequence (1381bp) was as follows (SEQ No.3):

[0043]AGCTGAGCGGTAGAGTTTCTTCGGAGACTTGAGAGCGGCGTACGGGTGCGGAACACGTGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATAGAGTGGCATCACTTTATATTGAAAACTGAGGTGGATAAAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCGATGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTTAGCGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTT...

Embodiment 3

[0045] Example 3: Biocatalysis of the original strain of Chryseobacterium sp.CA49

[0046] Strain cultivation: inoculate a small amount of slant seeds of Chryseobacterium sp.CA49 in the fermentation medium (the components are the same as in Example 1), culture at 30°C and 230rpm for 16-24 hours to prepare seed liquid, and use 0.5%-2% The inoculum amount is transferred to the fermentation medium for expanded cultivation, and the cultivation conditions are: 30°C, 230rpm, 24-48h.

[0047] Transformation of resting cells: The cells cultured in the first step were collected by centrifugation at 13,000 rpm, and washed twice with potassium phosphate buffer solution with a pH value of 7.0 and a concentration of 0.1M. The transformation system includes phosphate buffer (pH 7.0, 0.1M), bacteria, substrate and coenzyme cycle substrate. The coenzyme substrate is 5% to 10% (v / v) isopropanol and 2% to 5% (v / w) glucose. The cell concentration is 50-200g / L, the final substrate concentration...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of Chryseobacterium sp. CA49 (with an accession number of CCTCC M2012484), carbonyl reductase ChKRED20 coded by the genome of the strain and preparation of an aprepitant chiral intermediate (R)-1-[3,5-di(trifluoromethyl)phenyl]ethanol by using the original strain of Chryseobacterium sp. or the carbonyl reductase as a biocatalyst. The enantiomeric excess value of the produced intermediate is greater than 99.9%. Crude ChKRED20 enzyme powder can catalyze up to 200 g / L of a substrate and enables a conversion rate of more than 99% to be obtained in 24 h; a coenzyme circulating system is simple and cheap, the produced intermediate is easy to separate and purify, and a high recovery rate and good industrial application prospects are obtained.

Description

technical field [0001] The invention belongs to the field of applied microorganisms and enzyme engineering, and specifically relates to a strain of Chryseobacterium aureus and a novel carbonyl reductase encoded by its genome, and uses the bacteria or the carbonyl reductase as a biocatalyst to produce aprepitant chiral intermediate . Background technique [0002] Optically active (R)-1-[3,5-bis(trifluoromethyl)phenyl]ethanol is a key chiral intermediate of the drug Aprepitant (trade name "Emend") developed by Merk. The main function of aprepitant is to prevent and treat acute or delayed vomiting caused by chemotherapy. [0003] The current mainstream process for preparing the chiral intermediate is chemical synthesis. In recent years, with the continuous development of biocatalysis technology, researchers have actively explored the method of enzymatically catalyzing prochiral ketones to produce this intermediate, and screened some microbial strains with enantioselectivity &...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/53C12N9/04C12P7/22C12R1/01C12N1/20
Inventor吴中柳刘艳汤脱险裴小琼
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S