Carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate

A reductase and mutant technology, applied to carbonyl reductase mutants and their application fields in the preparation of (R)-4-chloro-3-hydroxy-butyrate, can solve the problems of low substrate concentration and the like, Achieve high substrate concentration, good industrial application prospects, and high stereoselectivity

Active Publication Date: 2020-05-19
FUDAN UNIV
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The technical problem to be solved by the present invention is to provide a YOL151W mutant protein with high catalytic activity, encoding the mutation The nucleic acid sequence of body protein is also provided, and a recombinant expression vector containing the nucleic acid sequence is also provided, and a preparation method of engineering bacteria containing the carbonyl reductase mutant gene and glucose dehydrogenase gene, and its asymmetric reduction of chloroacetylacetyl Ester (I), preparation ( R Application of )-4-chloro-3-hydroxy-butyrate (II)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate
  • Carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate
  • Carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030]Example 1, site-directed mutagenesis and recombinant expression vector pET28b-YOL151W F85M build

[0031] Site-directed mutagenesis was performed using TransStart FastPfu Fly DNA polymerase. First design mutation primers containing mutation point F85M:

[0032] Upstream primer: GGCCTCTCCAATGTGCTTTGATATCACTGACAGT

[0033] Downstream primer: TATCAAAGCACATTGGAGAGGCCGTATGTAGAAC;

[0034] PCR reaction system (50μL): wild-type pET28b-YOL151W template 50ng, 10μL 5×TransStart ® FastPfuFly Buffer, 8μL dNTPs (2.5mM each), 1μL (10μM) each of a pair of mutation primers, 10μL 5×PCR Stimulant, 2.5 units of TransStart FastPfu Fly DNA polymerase, add sterile distilled water to 50μL.

[0035] PCR amplification procedure: (1) denaturation at 98°C for 3 min; (2) denaturation at 98°C for 20s, (3) annealing at 65°C for 30s, (4) extension at 72°C for 8 min, steps (2)-(4) were carried out for a total of 20 cycles , the final extension at 72 °C for 10 min, and the product was stored at 4 °...

Embodiment 2

[0037] Example 2, genetically engineered bacteria E.coli BL21(DE3) / pET28b-YOL151W F85M Construction and inducible expression of / pACYC-GDH

[0038] Using the plasmid pET28b-YOL151W constructed in Example 1 F85M and laboratory-preserved pACYC-GDH to co-transform the expression host E. coli BL21(DE3), positive clones were obtained by screening, and the engineering bacteria were named as E. coli BL21(DE3) / pET28b-YOL151W F85M / pACYC-GDH. The engineered bacteria were inoculated into 5 mL of LB liquid medium containing kanamycin (25 μg / mL) and chloramphenicol (12.5 μg / mL) for activation for 8 h (37 °C, 200 rpm). Take the above activated culture and transfer it to 500 mL of LB liquid medium containing kanamycin (25 μg / mL) and chloramphenicol (12.5 μg / mL) at 1 / 100 of the inoculum size (37 °C, 200 rpm). ), when the absorbance density OD of the culture medium 600 When it reached 0.6, 0.1 mM IPTG was added for induction, the induction temperature was 18°C, and the induction ti...

Embodiment 3

[0039] Embodiment 3, engineering bacteria E. coli BL21(DE3) / pET28b-YOL151W F85M / pACYC-GDH whole-cell catalyzed asymmetric synthesis ( R )-4-chloro-3-hydroxy-butyric acid ethyl ester (100g grade)

[0040] Ethyl chloroacetoacetate (346.8 g) was added to the reaction kettle and stirred. Toluene (534 mL) was added and the temperature was maintained at 30 °C. Glucose (570.9 g) was added and stirred for 5 minutes. On the other hand, 260 g of the whole-cell catalyst was added to 1.2 L of 100 mM phosphate buffer (pH 6.7), and the mixture was stirred uniformly, and this bacterial slurry suspension was added to the above-mentioned toluene reaction mixture. The pH was monitored from time to time after the reaction started, using 2M K 2 CO 3 The solution was maintained at pH 6.7. When the GC-MS monitoring reaction was completed, 300 mL of ethyl acetate was added, and after stirring for 5 minutes, the reaction solution was centrifuged at 9500 rpm for 20 minutes. The organic phase...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of biological pharmacy and biological engineering, and particularly relates to a carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate. The carbonyl reductase mutant disclosed by the invention is obtained by replacing phenylalanine at the 85th site of a sequence shown as SEQ ID NO.2 with methionine, or is obtained by replacing one or more sites except the 85th site with amino acid residues on the basis that phenylalanine at the 85th site of the sequence shown as SEQ ID NO.2 is replaced with methionine.The invention also relates to a recombinant expression vector containing the carbonyl reductase mutant gene, an engineering bacterium containing the carbonyl reductase mutant gene and a glucose dehydrogenase gene, and application of the genetic engineering bacterium in preparation of (R)-4-chloro-3-hydroxy-butyrate by asymmetric reduction of chloroacetoacetate. Compared with a wild enzyme, the carbonyl reductase mutant disclosed by the invention has the advantages that the reducing capability on chloroacetoacetate is obviously improved and the carbonyl reductase mutant has good industrial application prospect.

Description

technical field [0001] The invention belongs to the technical fields of biopharmaceuticals and bioengineering, in particular to a carbonyl reductase YOL151W mutant and its encoding gene, to a method for preparing an engineered bacterium containing the carbonyl reductase mutant gene and a glucose dehydrogenase gene, and the gene Engineering bacteria in asymmetric reduction of chloroacetoacetate (I), preparation ( R )-4-chloro-3-hydroxy-butyrate (II). Background technique [0002] ( R )-4-chloro-3-hydroxy-butyrate is an important class of chiral compounds, and its structural formula is shown in compound (II) in the following reaction formula, in which R is C 1 -C 8 Alkyl or cycloalkyl, mono- or polysubstituted aryl or aralkyl. Compound (II) is widely used in the synthesis of many valuable drugs and active molecules, such as L-carnitine, a nutritional supplement for weight loss [Chinese Patent CN104726507, Literature Journal of Shenyang University of Chemical Technology, 20...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62
CPCC12N9/0006C12Y101/01184C12N15/70C12P7/62C12N15/52C12N1/20C12N15/74
Inventor陈芬儿黄则度王泽旭刘敏杰
OwnerFUDAN UNIV