Carbonyl reductase mutant and application thereof in preparation of (R)-4-chloro-3-hydroxy-butyrate
A reductase and mutant technology, applied to carbonyl reductase mutants and their application fields in the preparation of (R)-4-chloro-3-hydroxy-butyrate, can solve the problems of low substrate concentration and the like, Achieve high substrate concentration, good industrial application prospects, and high stereoselectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030]Example 1, site-directed mutagenesis and recombinant expression vector pET28b-YOL151W F85M build
[0031] Site-directed mutagenesis was performed using TransStart FastPfu Fly DNA polymerase. First design mutation primers containing mutation point F85M:
[0032] Upstream primer: GGCCTCTCCAATGTGCTTTGATATCACTGACAGT
[0033] Downstream primer: TATCAAAGCACATTGGAGAGGCCGTATGTAGAAC;
[0034] PCR reaction system (50μL): wild-type pET28b-YOL151W template 50ng, 10μL 5×TransStart ® FastPfuFly Buffer, 8μL dNTPs (2.5mM each), 1μL (10μM) each of a pair of mutation primers, 10μL 5×PCR Stimulant, 2.5 units of TransStart FastPfu Fly DNA polymerase, add sterile distilled water to 50μL.
[0035] PCR amplification procedure: (1) denaturation at 98°C for 3 min; (2) denaturation at 98°C for 20s, (3) annealing at 65°C for 30s, (4) extension at 72°C for 8 min, steps (2)-(4) were carried out for a total of 20 cycles , the final extension at 72 °C for 10 min, and the product was stored at 4 °...
Embodiment 2
[0037] Example 2, genetically engineered bacteria E.coli BL21(DE3) / pET28b-YOL151W F85M Construction and inducible expression of / pACYC-GDH
[0038] Using the plasmid pET28b-YOL151W constructed in Example 1 F85M and laboratory-preserved pACYC-GDH to co-transform the expression host E. coli BL21(DE3), positive clones were obtained by screening, and the engineering bacteria were named as E. coli BL21(DE3) / pET28b-YOL151W F85M / pACYC-GDH. The engineered bacteria were inoculated into 5 mL of LB liquid medium containing kanamycin (25 μg / mL) and chloramphenicol (12.5 μg / mL) for activation for 8 h (37 °C, 200 rpm). Take the above activated culture and transfer it to 500 mL of LB liquid medium containing kanamycin (25 μg / mL) and chloramphenicol (12.5 μg / mL) at 1 / 100 of the inoculum size (37 °C, 200 rpm). ), when the absorbance density OD of the culture medium 600 When it reached 0.6, 0.1 mM IPTG was added for induction, the induction temperature was 18°C, and the induction ti...
Embodiment 3
[0039] Embodiment 3, engineering bacteria E. coli BL21(DE3) / pET28b-YOL151W F85M / pACYC-GDH whole-cell catalyzed asymmetric synthesis ( R )-4-chloro-3-hydroxy-butyric acid ethyl ester (100g grade)
[0040] Ethyl chloroacetoacetate (346.8 g) was added to the reaction kettle and stirred. Toluene (534 mL) was added and the temperature was maintained at 30 °C. Glucose (570.9 g) was added and stirred for 5 minutes. On the other hand, 260 g of the whole-cell catalyst was added to 1.2 L of 100 mM phosphate buffer (pH 6.7), and the mixture was stirred uniformly, and this bacterial slurry suspension was added to the above-mentioned toluene reaction mixture. The pH was monitored from time to time after the reaction started, using 2M K 2 CO 3 The solution was maintained at pH 6.7. When the GC-MS monitoring reaction was completed, 300 mL of ethyl acetate was added, and after stirring for 5 minutes, the reaction solution was centrifuged at 9500 rpm for 20 minutes. The organic phase...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com