Recombinant lipase mutant, engineering bacteria and application of recombinant lipase mutant

A technology of mutant and lipase, which is applied in the field of preparation of dimethyl N-acetyl-piperidine-2,3-dicarboxylate, can solve the problem of low concentration of substrate in resolution reaction and low catalytic activity of lipase , long reaction time and other problems, to achieve the effect of less catalyst consumption, short reaction time and high substrate concentration

A technology of mutant and lipase, which is applied in the field of preparation of dimethyl N-acetyl-piperidine-2,3-dicarboxylate, can solve the problem of low concentration of substrate in resolution reaction and low catalytic activity of lipase , long reaction time and other problems, to achieve the effect of less catalyst consumption, short reaction time and high substrate concentration

CN109182298AActive Publication Date: 2019-01-11ZHEJIANG UNIV OF TECH

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lipase mutant, engineering bacteria and application of recombinant lipase mutant
  • Recombinant lipase mutant, engineering bacteria and application of recombinant lipase mutant
  • Recombinant lipase mutant, engineering bacteria and application of recombinant lipase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: Construction of recombinant lipase genetically engineered bacteria E.coli Rosetta(DE3) / pET22b-CALB

[0027] Candida antarctica lipase B (CALB) gene sequence was optimized by yeast codons to obtain pGEM-T-CALB plasmid by total gene synthesis. Design expression primer 1 (GG CCATGG CCTTACCTAGTGGTTCCGACCCTG), primer 2 (GG GCGG CCG CTCAATGATGATGATGGTGGTGAGGAGTAACAATTCCTGAAC) (the underlines are Nco I and Not I restriction enzyme sites), utilize high-fidelity Pfu DNA polymerase to amplify, obtain the lipase gene sequence of 951bp (nucleotide sequence is as shown in SEQ IN NO.1, The amino acid sequence is shown in SEQ IN NO.2). The amplified fragment was digested with Nco I and Not I restriction endonucleases, and the fragment was ligated with pET22b treated with the same restriction endonucleases using T4 DNA ligase to construct the expression vector pET22b-CALB. The constructed expression vector was transformed into E.coli Rosetta(DE3) competent cells to...

Embodiment 2

[0028] Example 2: Expression and screening of recombinant lipase mutants

[0029] Using the recombinant bacteria (E.coli Rosetta(DE3) / pET22b-CALB) containing the expression vector pET22b-CALB as the starting strain, the site-directed saturation mutation technique was used to further improve the ability of lipase to the substrate racemic N-acetyl-piperidine- Catalytic activity of dimethyl 2,3-dicarboxylate. Primers were designed as follows:

[0030] Leu / Ala(L / A)140 / 141 combination:

[0031] Upstream primer 5: 5'-ACTACAAAGGTACCGTGNDTNDTGGTCCACTTGACGCCTT-3'

[0032] Downstream primer 6: 5'-GAGAACTGTGATGTCAAAAGATCCTGCATGATCGATAAC-3'

[0033] Leu(L)144:

[0034] Upstream primer 7: 5'-AGGTACCGTGTTGGCTGGTCCANNKGACGCCTTGGCAGT-3'

[0035] Downstream primer 8: 5'-GGACACTGCCAAGGCGTCMNNTGGACCAGCCAACACGGT-3'

[0036] Ile (I) 189:

[0037] Upstream primer 9: 5'-CTCAGCTACAGACGAA NNK GTTCAGCCTCAAGTTAGT-3'

[0038] Downstream primer 10: 5'-CTAACTTGAGGCTGAAC MNN TTCGTCTGTAGCTGAG-3' ...

Embodiment 3

[0050] Embodiment 3: Construction of wild-type and mutant recombinant lipase genetically engineered bacteria Pichia pastoris X-33 / CALB and Pichia pastoris X-33 / CALB-muts

[0051] Using the pGEM-T-CALB plasmid as a PCR template, the expression primer 3 (GG CTCGAG AAAAGAGAGGCTGAAGCTTTACCTAGTGGTTCCGACC), primer 4 (GGT CTAGA TCAATGATGATGATGGTGGTGAGGAGTAACAATTCCTGAA) (the underlines are Xho I and Xba I restriction enzyme sites), utilize high-fidelity Pfu DNA polymerase to amplify, obtain the lipase gene sequence of 951bp (nucleotide sequence as shown in SEQ ID NO.1) . Use Xho I and Xba I restriction endonucleases to digest the amplified fragment, use T4 DNA ligase to connect the fragment with pPiczα-A treated with the same restriction endonuclease, and construct the vector pPiczα-A-CALB . The constructed vector was linearized with Sca I, and the linearized pPiczα-A-CALB was introduced into Pichia pastoris X-33 by electric shock transformation method, and then integrated into t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant lipase mutant, engineering bacteria and application of the recombinant lipase mutant in the preparation of (2S,3R)-N-acetyl-piperidine-2,3-dicarboxylic acid dimethyl ester. The mutant is prepared by the step of carrying out single mutation or combined mutation on a site 140, a site 141, a site144, a site 189 and a site 190 of an amino acid sequence representedby SEQ ID NO.2. Compared with wild enzyme, the mutant has the advantages that the catalytic activity and the substrate tolerance are greatly improved, and the time consumed in the reaction progress is obviously shortened. Compared with (S,S)-2,8-diazabicyclo[4,3,0]decane prepared by virtue of a chemical method, the produced prepared by virtue of the technique provided by the invention has the advantages of high stereoselectivity, relatively mild reaction condition, low facility request and environmental friendliness, and the reaction cost is lowered.

Description

(1) Technical field [0001] The invention belongs to the field of biopharmaceuticals and biotransformation, and in particular relates to an Antarctic Candida lipase B (CALB) mutant, a mutant gene, a recombinant vector containing the mutant gene, a recombinant genetically engineered bacterium containing the mutant gene and Antarctic Application of Candida lipase B mutant in the preparation of (2S,3R)-N-acetyl-piperidine-2,3-dicarboxylate dimethyl ester. (2) Background technology [0002] Lipase (Lipase, EC3.1.1.3), the system name is triacylglycerolacylhydrolase (triacylglycerolacylhydrolase), which mainly catalyzes the hydrolysis of triglycerides into glycerol and free fatty acids in the body. In industry, it is widely used in esterification And transesterification reactions such as transesterification, alcoholysis, acidolysis, and aminolysis. Lipase widely exists in organisms such as microorganisms, plants, and animals. Among them, microbial lipase has the characteristics o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
11 Jan 2019
Publication
CN109182298A
IPC
C12N9/20; C12N15/55; C12N15/70; C12N1/21; C12P17/12; C12P41/00; C12R1/19
CPC
C12N9/20; C12N15/70; C12P17/12; C12P41/001; C12Y301/01003
Inventors
柳志强; 郑裕国