Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of CBF1 gene for improving high-temperature tolerance of trichoderma viride

A technology of Trichoderma viride and high temperature tolerance is applied in the field of construction of CBF1 gene-transformed Trichoderma viride engineering bacteria, which can solve problems such as lack of stress resistance of Trichoderma viride, improve colonization ability and survival rate, and improve tolerance. The effect of improving the range and resistance to high temperature stress

Active Publication Date: 2014-01-22
SHENZHEN HE MIN BIOTECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current genetic engineering improvement of Trichoderma strains mainly focuses on improving the expression of Trichoderma-related hydrolytic enzymes, such as chitinases, cellulases, xylanases, dextran Enzymes (glucanase) and proteases (proteinases), etc., have little improvement on the stress resistance of Trichoderma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CBF1 gene for improving high-temperature tolerance of trichoderma viride
  • Application of CBF1 gene for improving high-temperature tolerance of trichoderma viride
  • Application of CBF1 gene for improving high-temperature tolerance of trichoderma viride

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Construction of CBF1 gene cloning and expression vector

[0037] Arabidopsis mRNA was extracted, reverse-transcribed into cDNA, and then used as a template to amplify the CBF1 gene fragment by PCR technology. Primers were designed according to the sequence of the CBF1 gene (GenBank: FJ169262.1) in the NCBI database, and the CACC nucleotide sequence was added before the start codon of the gene to facilitate cloning. Primer pairs are:

[0038] CBF1-F01 CACCATGAACTCATTTTCGACTTT,

[0039] CBF1-R642 TTAGTAACTCCAAAAGTGACACGT

[0040] After the PCR amplification reaction, the obtained target clone CBF1 gene fragment is 642bp in length (see SEQ ID No.1 for the sequence), and the result of PCR product electrophoresis on agarose gel is as follows: figure 1 , Carry out gel cutting recovery and purification of the target fragment. The product was recovered for the next step.

[0041] Gene cloning and vector construction using Gateway TM Cloning Technology (Invitrogen). Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an applicaton of a CBF1 gene for improving high-temperature tolerance of trichoderma viride and futher provides a construction method for a CBF1 gene-transferring trichoderma viride engineering bacterium. According to the application, a transcription factor CBF1 gene of a plant is cloned, and a fungus expression dual-element carrier of the gene is constructed and is transferred into the trichoderma viride with an agrobacterium mediating method, so that the CBF1 gene-transferring trichoderma viride is obtained, and the high temperature stress resistance is improved. The applicaton of the CBF1 gene for improving high-temperature tolerance of the trichoderma viride can improve the adaptability to the environment, further improve the biological prevention and control capacity and enlarge the usage of the trichoderma viride in a farmland, and has an important application prospect.

Description

(1) Technical field [0001] The invention relates to the application of CBF1 gene in improving the high temperature tolerance of Trichoderma viride, and a construction method of a CBF1 gene-transferred Trichoderma viride engineering bacterium. (2) Background technology [0002] Trichoderma (Trichoderma spp.) is a multifunctional filamentous fungus belonging to the subphylum Plechoporaceae. It is used in the biological control of plant diseases, the degradation of toxic substances in the soil environment and soil remediation, and the decomposition of soil organic matter. It has a wide range of uses in decomposing and improving micro-ecological flora, production of cellulase and utilization of cellulose substances. [0003] Trichoderma is the most successful biocontrol fungus for plant diseases so far. Common Trichoderma include Trichoderma viride (T.viride), Trichoderma harzianum (T.hazinum), and Trichoderma konigii (T.konigii). Some Trichoderma strains have been widely used ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/80C12N1/15C12R1/885
Inventor 朱廷恒王渭霞陈勇汪琨崔志峰
Owner SHENZHEN HE MIN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com