Unlock instant, AI-driven research and patent intelligence for your innovation.
NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication and preparation method of NS5B303shRNA
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of swine fever virus and lentivirus, applied in the field of preparation of NS5B303shRNA
Inactive Publication Date: 2014-04-02
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, there are still many questions about RNAi to be resolved, such as: the time and target site of RNAi; the interferon response in mammals; the exact mechanism of RNAi; off-target effects, etc.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0041] 1. Generation of ds oligo expressing NS5B303shRNA
[0042] With the help of the online design software (BLOCK-iT) of Invitrogen Company of the United States TM RNAi Designer), determine the DNAinsertion sequence corresponding to the specific shRNA fragment 303 required by the pEN / U6 vector, and send it to Yubao Bioengineering (Dalian) Co., Ltd. for synthesis and annealing to generate ds oligo. The insertion sequence is as follows:
[0043] NS5B303: 5’→3’
[0044] SEQ ID NO: 1: T CACCGGGAGAAATACAACCACAATCCGAA
[0045] GATTGTGGTTGTATTTCTCCC
[0046] SEQ ID NO: 2: B AAAAGGGAGAAATACAACCACAATCTTCG
[0047] GATTGTGGTTGTATTTCTCCC
[0048] 2. ds oligo is connected with pEN / U6 vector to construct pEN / U6-shRNA
[0049] 2.1 Generation of double-stranded oligonucleotide (ds oligo)
[0050] (1) Establish the following system in a 0.2ml PCR amplification tube:
[0051]
[0052] (2) Incubate the above reaction at 95°C for 4 minutes, and then ...
Embodiment 2
[0082] 1-6 steps are the same as embodiment 1
[0083] 7. Preparation of sample 2
[0084] Pig whole blood infected with classical swine fever virus was collected, centrifuged at 12,000 rpm and 4°C for 30 minutes, and the supernatant was filtered through a 0.22um filter membrane and then inoculated with PK-15 cells. For details of the inoculation method, see 7 in Example 1.
[0086] In order to verify the ability of positive PK-15 cell clones expressing NS5B303shRNA to inhibit the packaging ability of classical swine fever virus, the positive PK-15 cell clones screened were inoculated with the CFSV cytotoxicity cultured in step 7. After culturing for 24 hours, discard the culture medium, wash the cells twice with PBS buffer (pH7.6), 1.5 minutes each time, add pre-cooled 80% acetone after washing, put them in a -20°C refrigerator for 25...
Embodiment 3
[0090] 1-7 steps are the same as embodiment 2
[0091] 8. Real-time RT-PCR verifies the inhibitory effect test of NS5B303shRNA on the replication of swine fever whole blood virus, the method is the same as that of Example 1.
[0092] 9. Results
[0093] Compared with pU6-shRNA-CON and non-transgenic normal cells, the relative copy number of viral genes in pU6-shRNA-303 was lower, indicating that the interference group showed a strong ability to inhibit virus infection. see attached Figure 5 .
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses an NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication. The NS5B303shRNA contains a siRNA (Small Interfering Ribonucleic Acid) sequence and is prepared through constructing a lentiviral expression vector of a shRNA, obtaining replication deficient lentivirus and lentivirus infection PK-15 cells (pig kidney cells) and verifying a hog cholera virus replication inhibiting effect. The sequence has a remarkable effect for inhibiting the replication of hop cholera viruses on sensitive cells. Through research on RNA interference to replication inside / outside the hog cholera viruses, a lentiviral vector mediated and stably-integrated RNA interfering technology for targeting a specific conserved gene fragment of a hog cholera virusgenome is constructed, and siRNA transgenic animals for targeting the siRNA of hop cholera viruses are expected to be constructed. The necessary experimental data are accumulated for researching gene functions of the shRNA applied to the hop cholera viruses and preventing and treating hog cholera, and the previous preparation is provided for the animal breeding for disease resistance.
Description
[0001] This application is a divisional application of "application date: June 4, 2012, application number: 201210180327.2, name: RNAi for inhibiting the replication of classical swine fevervirus and its preparation method". technical field [0002] The present invention relates to a method for inhibiting the replication of classical swine fevervirus, specifically a NS5B303shRNA (NS non-structural protein, shRNA short hairpin RNA short hairpin deoxyribonucleic acid) for inhibiting the replication of classical swine fevervirus. The present invention also includes the preparation of NS5B303shRNA method. Background technique [0003] Classical swine fever (CSF) is one of the infectious diseases that seriously endanger the swine industry worldwide. In order to distinguish it from African swine fever, Europeans call it "Classical swine fever (CSF)". The pathogen is classical swine fever virus (CSFV). CSFV is an RNA virus belonging to the Flaviridae family (Flaviridae), a mem...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.