NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication and preparation method of NS5B303shRNA

A technology of swine fever virus and lentivirus, applied in the field of preparation of NS5B303shRNA

Inactive Publication Date: 2014-04-02
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many questions about RNAi to be resolved, such as: the time and target ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication and preparation method of NS5B303shRNA
  • NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication and preparation method of NS5B303shRNA
  • NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication and preparation method of NS5B303shRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] 1. Generation of ds oligo expressing NS5B303shRNA

[0042] With the help of the online design software (BLOCK-iT) of Invitrogen Company of the United States TM RNAi Designer), determine the DNA insertion sequence corresponding to the specific shRNA fragment 303 required by the pEN / U6 vector, and send it to Yubao Bioengineering (Dalian) Co., Ltd. for synthesis and annealing to generate ds oligo. The insertion sequence is as follows:

[0043] NS5B303: 5’→3’

[0044] SEQ ID NO: 1: T CACCGGGAGAAATACAACCACAATCCGAA

[0045] GATTGTGGTTGTATTTCTCCC

[0046] SEQ ID NO: 2: B AAAAGGGAGAAATACAACCACAATCTTCG

[0047] GATTGTGGTTGTATTTCTCCC

[0048] 2. ds oligo is connected with pEN / U6 vector to construct pEN / U6-shRNA

[0049] 2.1 Generation of double-stranded oligonucleotide (ds oligo)

[0050] (1) Establish the following system in a 0.2ml PCR amplification tube:

[0051]

[0052] (2) Incubate the above reaction at 95°C for 4 minutes, and then ...

Embodiment 2

[0082] 1-6 steps are the same as embodiment 1

[0083] 7. Preparation of sample 2

[0084] Pig whole blood infected with classical swine fever virus was collected, centrifuged at 12,000 rpm and 4°C for 30 minutes, and the supernatant was filtered through a 0.22um filter membrane and then inoculated with PK-15 cells. For details of the inoculation method, see 7 in Example 1.

[0085] 8. Detection of the ability of NS5B303shRNA to inhibit the expression of swine fever whole blood virus by indirect immunofluorescence

[0086] In order to verify the ability of positive PK-15 cell clones expressing NS5B303shRNA to inhibit the packaging ability of classical swine fever virus, the positive PK-15 cell clones screened were inoculated with the CFSV cytotoxicity cultured in step 7. After culturing for 24 hours, discard the culture medium, wash the cells twice with PBS buffer (pH7.6), 1.5 minutes each time, add pre-cooled 80% acetone after washing, put them in a -20°C refrigerator for 25...

Embodiment 3

[0090] 1-7 steps are the same as embodiment 2

[0091] 8. Real-time RT-PCR verifies the inhibitory effect test of NS5B303shRNA on the replication of swine fever whole blood virus, the method is the same as that of Example 1.

[0092] 9. Results

[0093] Compared with pU6-shRNA-CON and non-transgenic normal cells, the relative copy number of viral genes in pU6-shRNA-303 was lower, indicating that the interference group showed a strong ability to inhibit virus infection. see attached Figure 5 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an NS5B303shRNA (Short Hairclip Ribonucleic Acid) for inhibiting hog cholera virus replication. The NS5B303shRNA contains a siRNA (Small Interfering Ribonucleic Acid) sequence and is prepared through constructing a lentiviral expression vector of a shRNA, obtaining replication deficient lentivirus and lentivirus infection PK-15 cells (pig kidney cells) and verifying a hog cholera virus replication inhibiting effect. The sequence has a remarkable effect for inhibiting the replication of hop cholera viruses on sensitive cells. Through research on RNA interference to replication inside/outside the hog cholera viruses, a lentiviral vector mediated and stably-integrated RNA interfering technology for targeting a specific conserved gene fragment of a hog cholera virus genome is constructed, and siRNA transgenic animals for targeting the siRNA of hop cholera viruses are expected to be constructed. The necessary experimental data are accumulated for researching gene functions of the shRNA applied to the hop cholera viruses and preventing and treating hog cholera, and the previous preparation is provided for the animal breeding for disease resistance.

Description

[0001] This application is a divisional application of "application date: June 4, 2012, application number: 201210180327.2, name: RNAi for inhibiting the replication of classical swine fever virus and its preparation method". technical field [0002] The present invention relates to a method for inhibiting the replication of classical swine fever virus, specifically a NS5B303shRNA (NS non-structural protein, shRNA short hairpin RNA short hairpin deoxyribonucleic acid) for inhibiting the replication of classical swine fever virus. The present invention also includes the preparation of NS5B303shRNA method. Background technique [0003] Classical swine fever (CSF) is one of the infectious diseases that seriously endanger the swine industry worldwide. In order to distinguish it from African swine fever, Europeans call it "Classical swine fever (CSF)". The pathogen is classical swine fever virus (CSFV). CSFV is an RNA virus belonging to the Flaviridae family (Flaviridae), a mem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N15/867C12N15/10A61P31/14
Inventor 刘湘涛陈妍田宏吴锦艳尚佑军尹双辉王光祥靳野张克山杨顺利刘永杰
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap