Human adenovirus detection kit
A technology for detecting kits and human adenoviruses, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., can solve the problems of lack of a quality control system and low detection sensitivity of the kits, and achieves simple and convenient detection methods. The effect of high sensitivity and wide detection range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] This embodiment provides a specific adenovirus detection kit, which includes the following components:
[0034] ① Nucleic acid release agent: Contains 0.1mmol / L of surfactin, 100mmol / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.
[0035] ② Internal standard (positive internal control): It is a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 2.00E+04copies / ml, and the 100-base-pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.
[0036] ③PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleotide detection The upstream and downstream primers used for internal standard fragment amplification are b...
Embodiment 2
[0050] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting HAdV-DNA in unknown samples such as sputum and throat swabs:
[0051] 1. Reagent preparation
[0052] According to the number of samples to be tested, adenovirus negative control, adenovirus positive control, and adenovirus quantitative reference products A to D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) in proportion ) and internal standard 0.5 μl / person, mix thoroughly to form a PCR-mix; centrifuge briefly and set aside.
[0053] 2. Nucleic acid extraction
[0054] 1. Sputum sample: Add 2 to 3 times the volume of normal saline to the sputum sample, shake it well and let it stand for an hour to liquefy the sputum. Take 1000 μl of the liquefied sample in a 1.5ml centrifuge tube (avoid suctioning out obvious solid impurities), add 100 μl of human adenovirus concentrate to the centrifuge tube, oscil...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap