Human adenovirus detection kit

A technology for detecting kits and human adenoviruses, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., can solve the problems of lack of a quality control system and low detection sensitivity of the kits, and achieves simple and convenient detection methods. The effect of high sensitivity and wide detection range

Active Publication Date: 2014-04-16
SANSURE BIOTECH
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, there are scientific research kits for detecting HAdV-DNA based on real-time fluorescent quantitative PCR technology in foreign countries, but most of these kits use the boiling method to extract nucleic acid, and the detection sensitivity is not high, about 500-1000copies / ml; In addition, these reagents Most of the boxes lack a complete quality control system, and need to be further improved and the technical level to make such products more meet the needs of accurate clinical diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human adenovirus detection kit
  • Human adenovirus detection kit
  • Human adenovirus detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] This embodiment provides a specific adenovirus detection kit, which includes the following components:

[0034] ① Nucleic acid release agent: Contains 0.1mmol / L of surfactin, 100mmol / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.

[0035] ② Internal standard (positive internal control): It is a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 2.00E+04copies / ml, and the 100-base-pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.

[0036] ③PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleotide detection The upstream and downstream primers used for internal standard fragment amplification are b...

Embodiment 2

[0050] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting HAdV-DNA in unknown samples such as sputum and throat swabs:

[0051] 1. Reagent preparation

[0052] According to the number of samples to be tested, adenovirus negative control, adenovirus positive control, and adenovirus quantitative reference products A to D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) in proportion ) and internal standard 0.5 μl / person, mix thoroughly to form a PCR-mix; centrifuge briefly and set aside.

[0053] 2. Nucleic acid extraction

[0054] 1. Sputum sample: Add 2 to 3 times the volume of normal saline to the sputum sample, shake it well and let it stand for an hour to liquefy the sputum. Take 1000 μl of the liquefied sample in a 1.5ml centrifuge tube (avoid suctioning out obvious solid impurities), add 100 μl of human adenovirus concentrate to the centrifuge tube, oscil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention provides a human adenovirus (HAdV) detection kit. The kit comprises a nucleic releaser and PCR (polymerase chain reaction) liquid, wherein the nucleic releaser contains 0.01mM / L to 0.5mM / L of surfactin, 20mM / L to 300mM / L of potassium chloride, 0.01 to 2 percent of sodium dodecyl sulfate and 0.05 to 1 percent of ethanol; the PCR reaction liquid contains primers for HAdV detection and a probe sequence, wherein the HAdV upstream primer is AGTGTAACATGACCAAAGACTGGTTC, the HAdV downstream primer is AAGAAGGAGTACATGCGRTCCTT, and the HAdV probe is ACTACAACATTGGCTACCAGGGCTTCTA. The sensitivity of the kit for detecting the HAdV can reach 400copies / ml, and the quantitative linear range is 400 to 4.00 E+09copies / ml; by utilizing the kit, the HAdV-DNA (deoxyribonucleic acid) in unknown samples such as sputum and throat swab can be rapidly and accurately detected, and reliable experimental reference can be provided for the early diagnosis of the infection of the HAdV.

Description

technical field [0001] The invention provides a human adenovirus detection kit, in particular a fluorescent PCR-based adenovirus detection kit. Background technique [0002] Human adenoviruses (Human adenoviruses, HAdV) belong to the Adenoviridae family and are a group of widely distributed DNA viruses, which can be divided into six subspecies A to F, with a total of 51 serotypes. Adenoviruses are non-enveloped viruses that are It can exist stably in a pH environment and has a strong ability to resist the action of physical and chemical agents. Adenoviruses can produce tolerance to gastrointestinal secretions and bile, so adenoviruses can replicate in the gastrointestinal tract and produce high Viral load. Adenoviruses often multiply in the pharynx, conjunctiva, intestinal tract and lymphoid tissues, and cause various clinical symptoms, such as respiratory infection, conjunctivitis, gastroenteritis, hepatitis, hemorrhagic cystitis, Nervous system disorders, etc. Different a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/686C12Q1/70C12Q2523/113C12Q2545/101C12Q2521/531
Inventor 戴立忠艾颖娟邓中平
Owner SANSURE BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap