Red cone ssr2 marker, primer pair, preparation method and application thereof

A primer pair, red cone technology, applied in biochemical equipment and methods, DNA preparation, microbial determination/inspection, etc., can solve problems such as poor stability, inability to directly apply molecular marker-assisted breeding and QTL mapping, etc.

Inactive Publication Date: 2016-08-17
GUANGXI FORESTRY RES INST
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although scholars at home and abroad have used multiple markers such as ISSR and RAPD to study the genetic diversity of red cone populations, the genetic structure of red cone populations, and the genetic relationship and distance between red cones of different provenances, the two markers of ISSR and RAPD All are dominant markers with poor stability and cannot be directly applied to molecular marker-assisted breeding and QTL mapping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Red cone ssr2 marker, primer pair, preparation method and application thereof
  • Red cone ssr2 marker, primer pair, preparation method and application thereof
  • Red cone ssr2 marker, primer pair, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0028] Extraction and enzyme digestion of total DNA of red cone

[0029] Select the young leaves of Red Cone, and use CTAB method to extract the nuclear genome; digest with EcoRV at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;

[0030] Connection of connector

[0031] Connect the red cone genomic DNA digested by EcoRV in step to the upper and lower linkers (upper linker sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, sequence listing SEQ.ID.No.4; lower linker sequence ACCAGCCC-NH2, sequence listing SEQ.ID.No.5); The 60 μL ligation system contains 9 μL of enzyme-cut red cone genomic DNA, 100 pmol of the upper and lower adapters; the ligation reaction is carried out under the condition of 1 times T4 ligase buffer, and ligated overnight at 16°C; the ligated mixture is reacted at 65°C for 20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer pair, a castanopsis hystrix SSR2 (Simple Sequence Repeat 2) marker and a preparation method and application thereof. According to the preparation method, the total DNA (Deoxyribonucleic Acid) of castanopsis hystrix is subjected to PCR (Polymerase Chain Reaction) amplification by using the specific primer pair HZ2, thereby obtaining the SSR2 marker. The method is simple and feasible and is simple and convenient in operation; shown by tests which are carried out in members of two natural castanopsis hystrix populations and among the members, the obtained SSR has relatively high polymorphism. The castanopsis hystrix SSR2 marker is a co-dominant marker; compared with other molecular markers, the SSR marker is good in repeatability and high in reliability, can be applied to the genetic diversity evaluation of castanopsis hystrix, the genetic map construction of castanopsis hystrix, the research on the spatial distribution pattern of the genetic variation of castanopsis hystrix population and the origination and evolution of castanopsis hystrix and the standardization of target genes, and can also be applied to the molecular marker assisted breeding and QTL (Quantitative Trait Locus) research of castanopsis hystrix.

Description

technical field [0001] The invention belongs to the technical field of molecular markers in biological sciences, and in particular relates to a red cone SSR2 marker, a pair of primers and a preparation method and application thereof. Background technique [0002] Castanopsis hystrix is ​​an evergreen tree belonging to the genus Castanopsis of the Fagaceae family. It is an important native broad-leaved, high-quality and precious timber tree species in South China. It grows fast, adapts widely, and has high benefits. It can be used for construction, shipbuilding, and high-end furniture. It has strong germination power, dense branches and leaves, is more resistant to shade, and has good mixed growth performance. It can be planted in pure forests or mixed forests. It is a mixed forest of coniferous species. One of the most ideal companion tree species; the red cone has strong adaptability to the habitat, and is located in the arbor layer in the community. Because red cone wood ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor蒋燚刘海龙朱积余黄荣林姜英何应会
OwnerGUANGXI FORESTRY RES INST