Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof

A technology of fusion protein and coding gene, which is applied in the field of medicine and biology, can solve the problems of constructing fusion protein without AnnexinA5 and melittin, complex pharmacological effects, and limited application, so as to achieve the effect of improving killing effect, reducing drug dosage, and reducing damage

Inactive Publication Date: 2014-04-30
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the pharmacological effects of melittin are very complicated. In addition to its anti-tumor effect, it also has an impact on the major systems of the human body, and has strong toxic and side effects: such as hemolysis, paralysis of the respiratory center, and arrhythmia, which greatly limit its use in the human body. clinical application
[0006] At present, there are no related reports on the preparation of fusion proteins between AnnexinA5 and other tumor drugs, let alone reports on the construction of fusion proteins between AnnexinA5 and melittin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof
  • Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof
  • Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1 Obtaining of fusion gene mAnxA5-MLT

[0074] See figure 1 , the gene encoding annexin mAnxA5 and the gene encoding melittin were respectively amplified by PCR; and then connected by overlapping region extension method to obtain fusion gene pET28a-mAnxA5-MLT. Specific steps are as follows:

[0075] (1) Use primer a and primer b to amplify the entire coding gene of mAnxA5 gene. Wherein primer a is 5'GCG GAATTC ATGGCCTACTGTCGCTCCCT3', the primer is consistent with the 5' end of the annexin B1 coding sequence, and introduces an EcoR I restriction endonuclease site. Primer b: 5'TTGAAACTCATCGGCCCTGCA3'. PCR reactions were performed using high-fidelity pfu DNA polymerase with a dNTP concentration of 20 μM, Mg 2+ The concentration was 1.5 mM, the temperatures of denaturation, annealing, and extension were 94°C, 55°C, and 72°C, and the times were 45s, 45s, and 75s, respectively, and a total of 30 cycles were performed.

[0076] (2) Use primers c and d to amplif...

Embodiment 2

[0079] Example 2 Construction of expression plasmid pET28a-mAnxA5-MLT

[0080] The fusion gene mAnxA5-MLT amplified by the above method was sequenced using primers a and d (SEQ ID NO:3). After the sequencing was correct, it was digested with EcoR I and Sal I, and connected with the vector pET-28a (+) which was digested with EcoR I and Sal I. Restriction enzymes and T for digestion and ligation reactions 4 All ligases were purchased from TaKaRa Company, and the reaction was carried out using the system recommended by the enzyme instructions.

[0081] The inducible expression vector pET-28a (+) used in the present invention has a full length of 5369bp and contains a T7 promoter and a plasmid origin of replication (ori).

[0082] The specific reaction process is as follows: use EcoR I and Sal I to perform double enzyme digestion on the above PCR product and vector, and use a high-salt (H) buffer system for the reaction, and digest at 37°C for 3 hours. After separation by 1.0% ...

Embodiment 3

[0083] Embodiment 3 Preparation of engineering bacteria

[0084] The above ligated product was transformed into Escherichia coli strain BL21(DE3) to obtain engineering strain BL21 (pET28a-mAnxA5-MLT).

[0085] The specific steps are: first culture the host strain BL21 in 50ml LB medium (containing 1% tryptone, 0.5% yeast extract and 1% sodium chloride, pH 7.0) at 37°C until OD 600 At 0.4, centrifuge at 4000rpm at 4°C to collect the host bacteria; remove the supernatant and resuspend with 1-2ml ice-cooled 100mmol / L calcium chloride solution to obtain competent bacteria. Cool 100 ng of the plasmid constructed above and competent bacteria in an ice bath for 30 minutes, heat shock at 42° C. for 90 seconds, and then cool in an ice bath for 10 minutes. Add 0.8ml of LB, incubate at 37°C for 1 hour, take 0.2ml of the transformation product and smear it on an LB agar plate, and incubate at 37°C for 12-15 hours to obtain a single-clonal host bacterium containing the recombinant plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of the pharmaceutical biotechnology and provides a targeting anti-tumor fusion protein mAnx5-MLT, wherein the coding gene of the targeting anti-tumor fusion protein is the fusion gene mAnxA5-MLT of the mutant mAnxA5 of annexin 5 and a melittin gene. The invention also provides an expression plasmid pET28a-mAnxA5-MLT and engineering bacteria DH5alpha. The fusion protein is capable of acting targeting to phosphatidylserine in the extraneous coat of tumor cells and thus acting targeting to the tumor part, and capable of remarkably improving the anti-tumor effect of the melittin; in addition, the dosage of the melittin is reduced, so that the toxic and side effects of the melittin are reduced. The targeting anti-tumor fusion protein can be prepared into targeted anti-tumor drugs.

Description

technical field [0001] The invention relates to the field of medical and biological technology, in particular to a targeted anti-tumor fusion protein, its coding gene, expression plasmid and its application in the preparation of anti-tumor drugs. Background technique [0002] In recent years, with the in-depth study of tumor genetics and molecular biology, people have found some important molecules of tumor proliferation, differentiation, invasion and metastasis. On this basis, targeted drug therapy has gradually become an important means of tumor treatment. Different from conventional radiotherapy and chemotherapy drugs, targeted drugs can target tumor cells and kill cells in a targeted manner, thereby reducing the dosage of drugs; more importantly, targeted drugs can minimize damage to normal cells or tissues. damage, reduce side effects, improve curative effect and improve the quality of life of patients. Therefore, the research and development of targeted anti-tumor dru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N15/66A61K38/16A61K47/48A61P35/00
Inventor颜宏利邓安梅孙小波方超平
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY