Preparation method and application of fluorescent marker gene chip reagent for detecting ToRCH (toxopasma, rubella virus, cytomegalo virus and herpes virus)

A fluorescent labeling and gene chip technology, applied in the field of medical testing and biochips, can solve the problems of long operation time, complicated reagents, unfavorable test results of patients, etc., and achieve the effect of short time consumption and short time consumption

Inactive Publication Date: 2014-05-21
TAIYUAN UNIV OF TECH
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using immunological methods to detect the level of pathogen-specific antigens or antibodies in the peripheral blood of pregnant women has insufficient sensitivity and specificity, and because the reagents used are complicated and the operation time is long, it is not conducive for patients to know the test results in time; and for Pathogen infections that can cause fetal malformations, such as ToRCH, cannot be detected at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of fluorescent marker gene chip reagent for detecting ToRCH (toxopasma, rubella virus, cytomegalo virus and herpes virus)
  • Preparation method and application of fluorescent marker gene chip reagent for detecting ToRCH (toxopasma, rubella virus, cytomegalo virus and herpes virus)
  • Preparation method and application of fluorescent marker gene chip reagent for detecting ToRCH (toxopasma, rubella virus, cytomegalo virus and herpes virus)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] 1. Target sequence determination:

[0081] The present invention uses the following target sequences: According to the gene sequences of Toxopasma (Toxopasma), Rubella Virus (RubellaVirus), Cytomegalo Virus (Cytomegalo Virus), Herpes Simplex Virus Type I and Type II (Herpes Virus I / II), select a section The gene sequence with better specificity and appropriate fragment length is used as the target sequence for detection;

[0082] After the selected target sequence is searched by homology comparison, it is considered to be a sequence with high specificity;

[0083] Preferably, the present invention introduces the human actin β-action gene as a housekeeping gene to perform quality control on the inspection process, and the sequence is as follows:

[0084] TACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTG

[0085] ...

Embodiment 2

[0122] Using coxsackie virus, treponema pallidum, parvovirus, hepatitis B virus, HIV virus, chlamydia virus, toxoplasma gondii, rubella virus, cytomegalovirus, herpes simplex virus type I / II and other pathogen samples as templates, The primers and probes designed in this experiment were used for probe in situ hybridization, and the results showed that only Toxopasma, Rubella Virus, Cytomegalo Virus, Herpes Simplex virus I and II I / II) Fluorescent signal is generated, and the detection result is shown in Figure 2 to Figure 6 . Prove that the reagent prepared by the preparation method of the present invention has the ability to detect Toxopasma (Toxopasma), Rubella Virus (Rubella Virus), Cytomegalo Virus (Cytomegalo Virus), Herpes Simplex Virus I and Type II (Herpes Virus I / II) specificity.

Embodiment 3

[0124] In order to determine the detection sensitivity of the present invention, the above-mentioned gene fragment of the quality control gene human actin β-action is also subjected to a concentration gradient test. The β-action gene fragment was artificially synthesized in Shanghai Sangon Bioengineering Co., Ltd., the synthetic concentration was 1000ng / ml, and the known concentration of the gene fragment was diluted 10×, that is, diluted to 100ng / ml, 10ng / ml, 1ng / ml ml, 0.1ng / ml, 0.01ng / ml, 0.001ng / ml total 6 concentration gradients. Use the designed primers labeled with 5'cy3 to carry out fluorescent incorporation labeling PCR amplification. After diluting the aminated probe to 50pmol / ul with deionized water, take 0.5ul and add it dropwise on the aldehyde-based substrate, let it stand overnight at room temperature, and wash it successively with eluent I (5×SSC, 1% SDS), then Elute with dehydration II (0.25×SSC, 1% SDS) for 5 min each to elute unfixed probes, then centrifuge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a fluorescent marker gene chip reagent which can be used for simultaneously detecting ToRCH, namely five pathogens such as toxopasma, rubella virus, cytomegalo virus and pure herpes virus type I / II. Compared with the prior art, the preparation method has the characteristics of high specificity, high sensitivity and short operation time, and therefore, the preparation method has broad application prospect. In addition, the invention provides the reagent obtained by the preparation method and a kit used for the detection method.

Description

technical field [0001] The invention belongs to the field of medical inspection and biochip technology, and specifically provides a gene chip kit for five pathogenic microorganisms that are harmful to the human genitourinary tract: ToRCH (Toxopasma), rubella (Rubella) Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus type I and type II (Herpes Virus I / II) infection were detected simultaneously. Background technique [0002] ToRCH is the English abbreviation of a group of pathogenic microorganisms, where T (Toxopasma) is Toxoplasma gondii, R (RubellaVirus) is rubella virus, C (Cytomegalo Virus) is giant cell, H (Herpes Virus) is herpes simplex I and / or II type. Fetal malformations caused by Toxoplasma gondii infection include hydrocephalus, cerebellar malformation, chorioretinitis, and brain calcification; rubella virus infection can cause fetal congenital cataract, congenital heart disease, and neurological deafness; cytomegalovirus infection can cause fetal ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/6837C12Q1/04C12Q1/70
Inventor范晓军赵秋勇李瑶刘建红
OwnerTAIYUAN UNIV OF TECH