Screening method and application of plasma microRNA markers for identifying gastric cancer
A biomarker, cel-mir-39 technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, microbial determination / inspection, etc., can solve the problems affecting the reliability of screening results, etc., to achieve high sensitivity and strong specificity , the effect of improving reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1, Determination of the Concentration of Inserted Exogenous cel-miR-39 in Plasma
[0036] (1) Plasma RNA extraction
[0037] Take the same plasma sample and add 200 μL of plasma to RNase-free 1.5 mL centrifuge tubes. Subsequently, according to the operating instructions, use mirVana Paris Kit (SKU: AM1556, Ambion) for RNA extraction. The steps are slightly modified as follows: After adding 2× denaturing solution to the plasma, then add 2.5 μL successively with concentrations of 0.005, 0.05, and 0.5 , 5 μM cel-miR-39 solution, followed by adding phenol-chloroform mixture for centrifugation, adding phenol-chloroform mixture to the obtained upper aqueous phase again for mixing and centrifugation, and finally, washing with 100 μL 95°C preheated DEPC-treated water take off.
[0038] (2) qRT-PCR determination of cel-miR-39
[0039] reverse transcription:
[0040]Reverse transcription was performed with TaqMan MicroRNA Reverse Transcription Kit (SKU: 4366596, App...
Embodiment 2
[0045] Embodiment 2, cell microRNA detection
[0046] (1) Extraction of cellular RNA
[0047] First, gastric cancer cell line MGC803101 overexpressing miR-101 was constructed and cultured, gastric cancer cell line MGC803 and normal gastric mucosal epithelial cell line GES-1 were cultured simultaneously. Among them, the gastric cancer cell line overexpressing miR-101 was constructed by our laboratory, and the process was as follows: First, construct the hsa-miR-101 lentiviral expression vector. A 490bp fragment expressing miR-101 was amplified from DNA extracted from HEK293T cells, cloned into the pCDH1-CMV-MCS-EF1a-GFP-T2A-Puro expression vector, and a negative control Negative control was set at the same time; the primers adopted were as follows:
[0048] PCR primers:
[0049] miR-101-1F: CCTGAATTCATTCTAATTTAATTCAACTGG (SEQ ID NO: 7)
[0050] miR-101-1R: TATGGATCCTCAGCACAACATGGCTGCAC (SEQ ID NO: 8)
[0051] (Restriction site: EcoRI / BamHI)
[0052] Second, packaging len...
Embodiment 3
[0063] Example 3, large sample size plasma microRNA detection
[0064] (1) Plasma RNA extraction
[0065] Take a plasma sample and add 200 μL of plasma to an RNase-free 1.5 mL centrifuge tube. Subsequently, according to the operating instructions, use mirVana Paris Kit (SKU: AM1556, Ambion) for RNA extraction, the steps are slightly modified as follows: add 2× denaturing solution to the plasma, and then add 2.5 μL of 0.5 μM cel-miR- 39 solution, then add phenol-chloroform mixture for centrifugation, add phenol-chloroform mixture again to the obtained upper aqueous phase for mixing and centrifugation, and finally, use 100 μL 95°C preheated DEPC-treated water for elution.
[0066] (2) qRT-PCR detection of miR-21
[0067] The miR-21 sequence is shown in SEQ ID NO:6. For the reverse transcription steps, refer to the qRT-PCR measurement of cel-miR-39 described in Example 1.
[0068] qPCR:
[0069] Take 10 μL of cDNA solution obtained above, pipette 3 μL, and keep it for late...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap