A combined tandem repeat (tttacac) 5 dof protein
A technology of tandem repeat sequence and protein, applied in the field of Dof protein factor and its coding gene, can solve the problem of no Dof transcription factor combined with tandem repeat sequence, etc., and achieve the effect of improving plant gene expression activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Tandem Repeats (TTTACAC) 5 Fragment (named TR) synthesis and ligation with pUC18 cloning vector
[0024] Synthesis of three copies of tandem repeats (TTTACAC) 5 fragment, and add it at the beginning and end Eco RI (recognition sequence is 5'-GAATTC-3'), Sac I (recognition sequence is 5'-GAGCTC-3'), sfi IA (recognition sequence 5'-GGCCATTACGGCC-3') and sfi IB (recognition sequence is 5'-GGCCGCCTCGGCC-3') restriction enzyme cleavage site, the synthetic sequence information is as follows 5'- GAATTCGGCCATTACGGCC TTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACACTTTACAC GGCCGCCTCGGCCGAGCTC -3', where the underline is the added restriction enzyme site, the gene fragment was synthesized by Shanghai Sonny Biotechnology Co., Ltd. The fragment was linked with pUC18-T vector (purchased from Dalian Bao Bio) and transformed into E. coli Top10 competent cells (purchased from Shanghai Jierui Bioengineering Co., Ltd...
Embodiment 2
[0025] Example 2: Linking of TR fragment to yeast one-hybrid bait vector pHIS2
[0026] The pUC-TR plasmid obtained in Example 1 was EcoR I / Sac I double-enzyme cut, the cut fragment was linked to the pHIS2 (purchased from Shanghai Haike Biotechnology Co., Ltd.) vector with the same double-enzyme cut, and the ligation product was transformed into the transformant (pHIS2-TR) grown after the competent Escherichia coli was transformed. Twelve transformants were randomly selected and inoculated into the liquid LB medium with kana resistance. After shaking at 37°C and 250 rpm for 16 h (overnight), 1 µL of bacterial solution was taken for PCR amplification, and the products were amplified with 2% Agarose gel electrophoresis identification. Experiments show that the empty vector can amplify a fragment of about 150 bp, and the vector successfully inserted into the target fragment can amplify a fragment of about 300 bp. figure 1 It can be seen that bands 1, 2, 5, 7, and 12 may be...
Embodiment 3
[0027] Example 3: Transformation of yeast with pHIS2-TR plasmid
[0028] Pick Y187 yeast colonies from YPDA (complete medium) plates and inoculate them in 3 mL of YPDA liquid medium at 30°C, 220 rpm, and shake for 18-20 hours. Transfer YPDA liquid medium, the culture volume is 50 mL, make the initial OD 600 =0.2, 30°C, 220 rpm, shaking for 4-5 hours, to OD 600=0.6. Then, the cells were collected by centrifugation at 1000 g for 5 min at room temperature. Resuspend the cells with 20 mL of sterile water, mix well, centrifuge at 1000 g for 5 min at room temperature to collect the cells, and discard the supernatant. Resuspend the cells with 5 mL of 0.1 MLiAc (lithium acetate), mix well, centrifuge at 1000 g for 5 min at room temperature to collect the cells, and discard the supernatant. Resuspend the bacterial cells with 1 mL of 0.1 MLiAc, mix well, and dispense into 1.5 mL centrifuge tubes, each 100 µL, for later use. Add 240µL of 50% PEG3350, 36µL of 1M LiAc, 25µL of ssDNA (...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More