Biosynthesis method of 2-deoxy scarce aldose by using aldolase

A technology of phosphate aldolase and ribose, applied in the field of biology

Active Publication Date: 2014-09-03
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been related research reports that 2-deoxy-D-ribose can be synthesized from acetaldehyde and D-glyceraldehyde through 2-deoxy-D-ribose 5-phosphate aldolase, the catalytic reaction efficiency is low, and acetaldehyde tolerance lower

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosynthesis method of 2-deoxy scarce aldose by using aldolase
  • Biosynthesis method of 2-deoxy scarce aldose by using aldolase
  • Biosynthesis method of 2-deoxy scarce aldose by using aldolase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Design primers 1, 2, Primer 3 and primer 4, primer 1 contains an NdeI restriction site; in primer 2 and primer 3, the 200th amino acid codon is changed from the original TTT to ATC; primer 4 has a HindIII restriction site, Moreover, the 238th amino acid codon was changed from TCC to GAC, and the 258th AGC three bases were deleted.

[0032] The primer sequences are as follows:

[0033] Primer 1: 5'-GGGTTTCATATGCATCATCACCATCACCATACTGATTTATCTGCAA

[0034] GCAGCCTG-3'

[0035] Primer 2: 5'-AAAACCGTGGGCATCAAACCGGCGGGCGGCGTGCGTACTG-3'

[0036] Primer 3: 5'-AACCGTGGGCATCAAACCGGCGGGCGGCGTG-3'

[0037] Primer 4: 5'-ACTCAAGCTTTTAGCTGCTGGCGCTCTTACCGTC-3'

[0038] 2. Using the genome of Klebsiella pneumoniae MGH 78578 as a template, use primer 1 and primer 2, primer 3 and primer 4 to amplify respectively, and obtain fragment (1) (637bp, sequence 6 in the sequence listing) and fragment (2) respectively ) (200bp, sequence 7 in the sequence listing); fragment (1) and fragment...

Embodiment 2

[0044] 1. According to the 2-deoxy-D-ribose 5-phosphate aldolase gene of Klebsiella pneumoniae MGH 78578 in Genbank (Genbank number: 5341458, 780bp, sequence 5 in the sequence table), design primer 5 and primer 5 band There is a HindIII enzyme cutting site, the 258th amino acid codon is changed from the original AGC to ACC; the 259th amino acid codon is changed from the original TAC to ACC; and a paragraph is added after the 259th amino acid codon Codon sequence: AAAACCCAGCTGTCCTGCACCAAATGG.

[0045] The primer sequences are as follows:

[0046] Primer 5: 5'-ACTCAAGCTTTTACCATTTGGTGCAGGACAGCTGGGTTTTGGTGGTGCTG

[0047] GCGCTCTTACCGTCGC-3'

[0048] 2. Using the Klebsiella pneumoniae MGH 78578 genome as a template, use primer 1 and primer 2, primer 3 and primer 5 to amplify respectively, and obtain fragment (1) and fragment (3) respectively (fragment (1) 637bp, sequence Sequence 6 in the list; Fragment (3) 230bp, sequence 8 in the sequence listing); Fragment (3) and Fragment (4...

Embodiment 3

[0052] 1. Cultivation and induction of Escherichia coli recombinant strains carrying pELK-1 or pELK-2 recombinant plasmids

[0053] Select LB medium (peptone (10g / L), yeast extract (5g / L), sodium chloride (10g / L), add ampicillin antibiotic (100mg / L) to the medium, at 37°C, 200rmp The Escherichia coli recombinant strain L1 was cultured under OD 600 When it reaches 0.6-0.8, add IPTG with a final concentration of 1 mmol, reduce the speed of the shaker to 120 rpm, and induce for about 20 hours.

[0054] 2. Collection and concentration of Escherichia coli recombinant strains

[0055] Centrifuge the induced Escherichia coli recombinant strain (100mL) at 4°C and 8000rmp for 15min to collect the bacteria, wash the bacteria twice with triethanolamine buffer (50mmol, pH 7.0), and finally rinse with triethanolamine buffer (50mmol, pH 7.0) Concentrate the bacterial solution to 10mL.

[0056] 3. Ultrasonic wall breaking and Ni column purification

[0057]Centrifuge the induced Escheric...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a biosynthesis method of 2-deoxy scarce aldose such as 2-deoxy-D-ribose aldolase by using aldolase, and discloses protein sequences of two 2-deoxy-D-ribose 5-phosphate aldolase mutants, and a constructed Escherichia coli recombinant bacterial strain L1 containing encoding genes of the 2-deoxy-D-ribose 5-phosphate aldolase mutants. Experiments show that the recombinant strain can catalyze reaction of acetaldehyde and a variety of aldehyde groups to produce 2-deoxy aldose by using resting cells, and has strong substrate tolerance. For example, recombinant strain can synthesize 2-deoxy-D-ribose by using aldehyde and D-glyceraldehyde as substrates, synthesize 2-deoxy-L-ribose by using acetaldehyde and L-glyceraldehyde as substrates, and synthesize 2-deoxy-D-altrose by using acetaldehyde and D-erythrose as substrates. Therefore, the Escherichia coli recombinant bacterial strain L1 provided by the invention can be applied to the production of deoxidation deoxy scarce aldose, and the obtained deoxy aldose has wide application prospect in the industries of food and medicine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a 2-deoxy-D-ribose 5-phosphate aldolase mutant and its application in deoxysugar biosynthesis. That is to use the method of site-directed mutagenesis to obtain 2-deoxy-D-ribose 5-phosphate aldolase mutants, and use engineering bacteria carrying 2-deoxy-D-ribose 5-phosphate aldolase mutants to efficiently biosynthesize 2-deoxy -D-ribose and other deoxy rare aldoses. Background technique [0002] The asymmetric synthesis of C-C bonds is considered to be one of the most challenging topics in the field of organic synthesis. The asymmetric synthesis of C-C bonds in vivo is mainly completed by ligases. Aldehyde condensation reaction is one of the effective tools for C-C bond asymmetric synthesis (Brovetto M, Gamenara D, Saenz Mendez P, Seoane GA. C-C bond-forming lyases in organic synthesis. Chemical Reviews 2011.111:4346-4403). Currently, four aldolases have been reported: d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N1/21C12P19/02C12R1/19
CPCC12N9/88C12P19/02C12Y401/02004
Inventor孙媛霞李季涛杨建刚朱玥明门燕马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI