Kit and method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini
A kit and technology of donkey-hide gelatin, applied in the field of molecular biology, can solve the problems of difficult amplification of PCR products, low DNA content, high experimental cost, etc., and achieve the effect of high DNA purity, short time consumption and good purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1. With various types of commercially available donkey-hide gelatin, compound donkey-hide gelatin paste (1), donkey-hide gelatin blood-enhancing oral liquid (2), donkey-hide gelatin paste (3) and instant donkey-hide gelatin soup (4) four common donkey-hide gelatin products are materials, according to DNA was extracted by the following steps:
[0034]Step 1, reagent preparation and experimental equipment preparation: preparation of digestion buffer, prepare 2ml centrifuge tube, sterilize in autoclave, and set aside;
[0035] Step 2: Digest and decompose protein with digestive juice: take four common donkey-hide gelatin products, compound donkey-hide gelatin pulp (F), donkey-hide gelatin blood-enhancing oral liquid (E), donkey-hide gelatin paste (S) and instant donkey-hide gelatin soup, and use a pipette to absorb 200 -300ul liquid into a 2ml sterile centrifuge tube, take 0.3-0.5mg donkey-hide gelatin soup, grind it into powder with liquid nitrogen, put it into...
Embodiment 2
[0042] Example 2. Common PCR detection DNA extraction effect
[0043] In this example, compound donkey-hide gelatin paste (a), donkey-hide gelatin blood-reinforcing oral liquid (b), and donkey-hide gelatin cream (c) and instant donkey-hide gelatin soup (d) extracted by the present invention are used as templates, and the mitochondrial 16SrRNA gene is selected as the research object. Search the gene sequence in GeneBank, design donkey-specific universal primers, carry out PCR amplification, and check the amplification effect.
[0044] 1. Primer sequence:
[0045] Forward primer: AAGACGAGAAGGGAACCCTTGGAC
[0046] Reverse primer: GCGCTGTTTAATCCCCATAGG
[0047] 2. PCR reaction
[0048] (1) Perform PCR amplification with 4 types of donkey-hide gelatin DNA and donkey meat DNA positive control as templates, and the 25 μl reaction system includes the following solutions or reagents:
[0049]
[0050]
[0051] (2) After exploring the experimental conditions through gradient P...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com