Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit and method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini

A kit and technology of donkey-hide gelatin, applied in the field of molecular biology, can solve the problems of difficult amplification of PCR products, low DNA content, high experimental cost, etc., and achieve the effect of high DNA purity, short time consumption and good purity

Active Publication Date: 2014-09-17
VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional method of identifying donkey-hide gelatin is mainly realized by observing the product appearance, color, smell, etc. However, it is difficult to distinguish the authenticity of donkey-hide gelatin boiled from mule and horse hide, which are closely homologous to donkey hide
In recent years, with the development of molecular biology technology, some biological identification methods based on DNA have been gradually enriched. The patent publication number CN1605868A uses PCR-RFLP to identify animal skins such as donkey skins, but this method is only applicable to animal skins and not It is suitable for the identification of finished donkey-hide gelatin. After being exposed to high temperature and high pressure for a long time, the DNA content of donkey-hide gelatin is very small and has been degraded into small fragments. It is difficult to amplify long-segment PCR products.
The patent with the publication number CN101270357A provides a method for extracting DNA from deep-processed traditional Chinese medicine or traditional Chinese medicinal materials, but this method requires a large amount of raw materials in a 50ml centrifuge tube, which is time-consuming and laborious, and must be extracted using imported commercial kits, resulting in high experimental costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini
  • Kit and method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini
  • Kit and method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1. With various types of commercially available donkey-hide gelatin, compound donkey-hide gelatin paste (1), donkey-hide gelatin blood-enhancing oral liquid (2), donkey-hide gelatin paste (3) and instant donkey-hide gelatin soup (4) four common donkey-hide gelatin products are materials, according to DNA was extracted by the following steps:

[0034]Step 1, reagent preparation and experimental equipment preparation: preparation of digestion buffer, prepare 2ml centrifuge tube, sterilize in autoclave, and set aside;

[0035] Step 2: Digest and decompose protein with digestive juice: take four common donkey-hide gelatin products, compound donkey-hide gelatin pulp (F), donkey-hide gelatin blood-enhancing oral liquid (E), donkey-hide gelatin paste (S) and instant donkey-hide gelatin soup, and use a pipette to absorb 200 -300ul liquid into a 2ml sterile centrifuge tube, take 0.3-0.5mg donkey-hide gelatin soup, grind it into powder with liquid nitrogen, put it into...

Embodiment 2

[0042] Example 2. Common PCR detection DNA extraction effect

[0043] In this example, compound donkey-hide gelatin paste (a), donkey-hide gelatin blood-reinforcing oral liquid (b), and donkey-hide gelatin cream (c) and instant donkey-hide gelatin soup (d) extracted by the present invention are used as templates, and the mitochondrial 16SrRNA gene is selected as the research object. Search the gene sequence in GeneBank, design donkey-specific universal primers, carry out PCR amplification, and check the amplification effect.

[0044] 1. Primer sequence:

[0045] Forward primer: AAGACGAGAAGGGAACCCTTGGAC

[0046] Reverse primer: GCGCTGTTTAATCCCCATAGG

[0047] 2. PCR reaction

[0048] (1) Perform PCR amplification with 4 types of donkey-hide gelatin DNA and donkey meat DNA positive control as templates, and the 25 μl reaction system includes the following solutions or reagents:

[0049]

[0050]

[0051] (2) After exploring the experimental conditions through gradient P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and a method for quickly extracting DNA (deoxyribonucleic acid) from colla corii asini. A combined technology of an SDS (sodium dodecyl sulfate)-protease K and Chelex-100 combined process DNA extraction technology and a Glassmilk DNA purification technology is applied to DNA extraction of the colla corii asini. The dosage of needed colla corii asini paste is controlled to be 0.3ml to 0.5ml, the weight of colla corii asini blocks can be controlled to be 0.2mg to 0.6mg, and extracted DNA is high in concentration, excellent in purity, stable and difficult to degrade; due to extracted DNA, sequence fragments of 100bp-500bp can be amplified, and subsequent molecular biology experiments of gene cloning, sequencing and the like can be carried out. According to the method, the operation is simple, the dosage is low, and the consumed time is short; the method is especially suitable for DNA extraction of various types of colla corii asini products with low nucleic acid content and high degradation degree caused by deep processing; a foundation is provided for realizing colla corii asini source identification by adopting a DNA molecular biology identification technology.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for rapidly and efficiently extracting DNA from donkey-hide gelatin and a kit thereof. Background technique [0002] Donkey-hide gelatin is a jelly made from the dehaired skin of an equine animal donkey. It has a wide range of medical and health care values. Therefore donkey-hide gelatin occupies an important position in the market as a kind of health food, and is deeply favored by consumers. However, with the continuous development of the gelatin market, the shortage of raw material supply and the rise in raw material prices, in order to reduce costs, lawbreakers, in the process of preparing donkey-hide gelatin, partly or completely mix horsehide, cowhide, pigskin, mule The "fake donkey-hide gelatin" made in this way is very similar to the real donkey-hide gelatin in appearance and texture, and the price is low. The existence of such counterfeit products not...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/68
Inventor 步迅张全芳刘艳艳
Owner VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI