Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer for detecting pomegranate dry-rot germs and detection method for detecting pomegranate dry-rot germs by using primer

A pomegranate dry rot pathogen and primer sequence technology, applied in biochemical equipment and methods, microbe measurement/inspection, DNA/RNA fragments, etc., can solve difficult pathogenic bacteria and affect the accurate isolation of pathogenic bacteria, etc.

Active Publication Date: 2014-09-24
PLANT PROTECTION & QUALITY & SAFETY OF AGRI PRODS INST ANHUI ACAD OF AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the disease is isolated by conventional methods, many miscellaneous bacteria will be produced, which will affect the accurate isolation of pathogenic bacteria. It is difficult to quickly and accurately identify the pathogenic bacteria with conventional disease diagnosis techniques.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting pomegranate dry-rot germs and detection method for detecting pomegranate dry-rot germs by using primer
  • Primer for detecting pomegranate dry-rot germs and detection method for detecting pomegranate dry-rot germs by using primer
  • Primer for detecting pomegranate dry-rot germs and detection method for detecting pomegranate dry-rot germs by using primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1: design, synthesize primer and set up the PCR reaction system of pomegranate dry rot pathogen

[0023] 1. Primer design and synthesis

[0024] Design of specific primers: After analyzing the rDNA-ITS sequences of Coniella granati and other genera in GeneBank, a pair of specific primers were designed with the following sequences:

[0025] S1: AAGGACACAACCCCAGATAC

[0026] S2: ATAAACTACTACGCTCAGAG. The designed primers were re-analyzed by BLAST in GeneBank to verify their specificity.

[0027] At the same time, a pair of phytopathogenic fungal ITS general primers ITS1 and ITS4 were used as outer primers for nested PCR, and the sequences were as follows:

[0028] ITS1: TCCGTAGGTGAACCTGCGG

[0029] ITS4: TCCTCCGCTTATTGATATGC

[0030] All primers were commissioned to be synthesized by Shanghai Sangong Synthesis Department.

[0031] 2. Establish a conventional PCR reaction system

[0032] Conventional PCR amplification system is: 10×Taq buffer 2.5μL, 25mmo...

Embodiment 2

[0035] Embodiment 2: Preparation of DNA template

[0036] Extract DNA from various samples as templates for PCR reactions. The specific process is as follows:

[0037] 1. Mycelium cultivation, collection and DNA extraction

[0038] PDA medium: 20g agar powder, 200g potatoes, 20g glucose, add water to 1L. Transfer the test bacteria to the PDA medium plate, culture in the dark at 20°C for 5 days, cut 10 pieces of 2cm × 2cm colony pieces from the edge of the colony, transfer to the PDA liquid medium, shake and culture at 28°C for 7 days, collect the mycelia by filtration, and Freeze in liquid nitrogen and grind into powder, and store at -20°C for later use.

[0039] Genomic DNA was extracted according to the CTAB method provided by molecular cloning, and the specific operations were as follows:

[0040]Take a small amount of mycelium powder, add 900 μL 2% CTAB extract and 90 μL 10% SDS, vortex and mix well, place in a water bath at 60°C for 1 hour, during this period, turn it ...

Embodiment 3

[0043] Example 3: Detection of specificity and sensitivity of primers

[0044] 1. Specificity detection See Table 1 for the bacterial strains used in the present invention and related information. Adopt the specific primer designed by the present invention to carry out PCR amplification to all test bacterial strain genomic DNAs in table 1, can only specifically amplify a 450bp band from Coniella granati bacterial strain, and other test bacterial strains and blank There was no amplified band in the control. It indicated that the primer had species specificity and could distinguish Coniella granati from other species.

[0045] Table 1 is used for screening the bacterial strain of primer specificity in the present embodiment

[0046] strain

Number of strains

Amplify results with S1 / S2

Coniella granati

1

+

Alternaria alternata

2

-

Botryosphaeria dothidea

2

-

Botrytis cinerea

2

-

Coniothyrium dipl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular detection method of pomegranate dry-rot germs and a primer applied to the method, and builds a set of rapid, efficient, stable and reliable molecular detection method for detecting the pomegranate dry-rot germs. The method disclosed by the invention is accurate, rapid, simple and easy to operate, can be used for identifying pathogens during the initial infection stage of a disease, can be applied to field investigation and detection of plant products and has an important significance for controlling large-area outbreak and cross-regional transmission of a pomegranate dry rot disease; meanwhile, the construction of the system also provides technical guidance and theoretical support for detection of other pathogens.

Description

technical field [0001] The invention relates to a primer for detecting pomegranate dry rot pathogen and a molecular detection method using the primer to detect pomegranate dry rot pathogen. Background technique [0002] Pomegranate dry rot fungus (Coniella granati) causes dry rot of pomegranate fruit. The disease has been reported in Greece, South Korea, Turkey and other countries, and also occurred in many provinces of my country, but there are great differences in the identification of its pathogen. Isolation of the disease by conventional methods will produce a lot of miscellaneous bacteria, which will affect the accurate isolation of the pathogenic bacteria. It is difficult to quickly and accurately identify the pathogenic bacteria with conventional disease diagnosis techniques. With the development of molecular biology technology, the use of molecular detection methods provides a good detection method for the diagnosis of the disease. Contents of the invention [00...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6895
Inventor 陈雨杨雪张爱芳
Owner PLANT PROTECTION & QUALITY & SAFETY OF AGRI PRODS INST ANHUI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More