Application of bacillus axarquiensis to prevention and treatment of verticillium dahliae

A technology of Bacillus asalki and cotton verticillium wilt, which is applied in the agricultural field, can solve the problems of no related reports on the disease prevention effect of cotton verticillium wilt, no related research on biological activity and the like.

Inactive Publication Date: 2014-10-08
TARIM UNIV
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] According to the literature survey, the current research on Bacillus axalkia is limited to its taxonomy, but there is no relevant research on its biological activity, especially its effect on cotton Verticillium wilt disease prevention.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of bacillus axarquiensis to prevention and treatment of verticillium dahliae
  • Application of bacillus axarquiensis to prevention and treatment of verticillium dahliae
  • Application of bacillus axarquiensis to prevention and treatment of verticillium dahliae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1: Antagonist primary screening and secondary screening

[0014] Cotton Verticillium dahliae bacterial liquid preparation: inoculate Verticillium dahliae V.dahliae ATCC36211 on a plate containing PDA medium, culture at 25°C for 15 days, add sterile water to the plate, scrape the spores, count them with a hemocytometer, and adjust the concentration of the bacterial liquid 6×10 6 Spore mL -1 ,spare.

[0015] Isolation and screening of antagonistic bacteria: according to the routine method of isolating soil bacteria. The isolated and purified single colonies were inoculated on NA medium, cultured at 37°C for 48 hours at 180 rpm, and made into fungus cakes with a 6mm hole punch. Spread 200 μL 6×10 on PDA medium 6 mL -1 Cotton Verticillium dahliae spore suspension, and then the bacteria cake of the isolated and purified strain was reversely connected to the plate. Incubate at 25°C for 4 days, and screen for antagonistic bacteria that produce inhibition zones. ...

Embodiment 2

[0022] Example 2: Morphological and physiological and biochemical identification of antagonistic bacteria TUBP1. The activated antagonistic bacteria TUBP1 strain was inoculated on NA plates and cultured at 37°C for 48 hours, and Gram staining was performed to observe the colony morphology, bacteria and spores, and physiological and biochemical identification (methyl red test, starch hydrolysis test, sugar alcohol fermentation test, fluorochrome test, etc.).

[0023] The colony and morphological characteristics of Verticillium dahliae antagonistic strain TUBP1, TUBP1 grows on NA medium, the single colony of TUBP1 is round, the surface is shrunken, dry, dull, opaque, the edge is not smooth, milky white ( figure 1 A), Gram staining is positive (G+), and it has spores, motility, and metachromosomal tests are positive. Observed under a scanning microscope, the bacteria were rod-shaped ( figure 1 B)

[0024] Physiological and biochemical assay results of Verticillium dahliae anta...

Embodiment 3

[0029] Example 3: Phylogenetic analysis of Verticillium dahliae antagonistic bacteria TUBP1 based on BLAST results of 16S rDNA and gyrB gene sequences

[0030] Antagonistic bacterial TUBP1 gene sequence PCR amplification, 16S rDNA PCR amplification, antagonistic bacterial TUBP1 genomic DNA was extracted as a template, and universal primers were used for 16S rDNA sequence PCR amplification. The amplified product was cloned and sent to Shanghai Sangon Bioengineering Technology Service Co., Ltd. for sequencing. The result is shown in SEQ ID No1.

[0031] PCR amplification of gyrB gene sequence, extraction of antagonistic TUBP1 DNA, and degenerate primers UP-1S (5'GAA GTCATCATGACCGTTCTGCA3', SEQ ID No2) and UP-2Sr (5'AGCAGGGTAC GG ATGTGCG A GCC3', SEQ ID No3) Amplify the gyrB gene, reaction conditions: 95°C for 5min; 95°C for 30s, 58°C for 45s, 72°C for 2min, 30 cycles; 72°C for 10min. The amplified product was cloned and sent to Shanghai Sangon Bioengineering Technology Service ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a prevention and treatment effect on verticillium dahliae by using antagonistic fungi, namely bacillus axarquiensis. An antagonistic strain TUBP1 which has high antifungal activity on verticillium dahliae is obtained by separating via preliminary screening and secondary screening through an agar plate diffusion method. The strain is determined to be bacillus axarquiensis through morphologic observation, physiological and biochemical experiments and gene sequence analysis of 16S rDNA (ribosome Deoxyribose Nucleic Acid) and gyrB; the antifungal activity of fermentation liquid on verticillium dahliae is determined by using a growth rate method and an oxford cup method respectively; the growth inhibition rate on mycelium of verticillium dahliae is 78.62+ / -3.48% and the diameter of an inhibition zone is 21+ / -3.86mm; in a room-temperature pot experiment, the bio-control effect of the TUBP1 is 42.56%; in a plot experiment, the bio-control effect of the TUBP1 is 40.16%. An in vitro live test shows that the antagonistic fungi, namely bacillus axarquiensis can be used for preparing a medicine for preventing and treating verticillium dahliae.

Description

technical field [0001] The invention relates to the application of bacillus axalgia in preventing and treating cotton verticillium wilt, and belongs to the field of agricultural technology. Background technique [0002] Cotton verticillium wilt is a soil-borne vascular fungal disease caused by Verticillium dahliae Kleb. It is also one of the devastating diseases in cotton production, seriously affecting cotton yield and quality. Cotton Verticillium dahliae can be transmitted in various ways and ways such as seeds, soil, and fungal disease-carrying strains, and can form microsclerotia and survive in the soil for many years, so it is very difficult to control. Since the 1990s, cotton verticillium wilt has been increasing year by year, and has caused huge economic losses. According to incomplete statistics, it leads to an annual production reduction of 10% to 30%. [0003] The use of biological control of Verticillium wilt in cotton has attracted much attention. Biological c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01N63/00A01P3/00
Inventor曾红杨生强高艳红
OwnerTARIM UNIV