Engineering bacterium and method for preparing tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate

A technology of tert-butyl hydroxycaproate and engineering bacteria, which is applied in the field of preparing 6-cyano-3 and engineering bacteria, can solve the problems of increasing difficulty, increasing the difficulty of post-processing, increasing production cost and the like, and achieves a reduction in production cost. Effect

Active Publication Date: 2014-10-08
ZHEJIANG UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this process requires the joint action of two enzymes to complete the coenzyme cycle, resulting in increased production costs
At the same time, the gluconic acid produced in the reaction will change the pH value of the reaction system, which needs to be controlled by adding an alkaline solution, which increases the difficulty of controlling the reaction conditions, and the gluconic acid dissolved in the reaction solution will also greatly increase the post-treatment. difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium and method for preparing tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate
  • Engineering bacterium and method for preparing tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate
  • Engineering bacterium and method for preparing tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Construction of plasmid pET30-HHDH

[0050] The hhdh gene was cloned with primers F_HHDH / R_HHDH to obtain a hhdh gene with a length of 765bp. Nucleic acid electrophoresis to verify gene size, such as figure 2 .

[0051] The sequence of primer F_HHDH is:

[0052] 5'-CGCGGATCCATGTCAACCGCAATTGTAAC-3';

[0053] The sequence of primer R_HHDH is:

[0054] 5'-CCGCTCGAGCTACTCTGGCATACCAGG-3'.

[0055] The hhdh gene sequence is as follows:

[0056] ATGTCAACCGCAATTGTAACAAACGTTAAGCATTTTGGGGGAATGGGGTCTGCACTTCGTCTCTCGGAAGCAGGACATACAGTGGCTTGCCACGATGAAAGCTTCAAACACCAAGACGAACTTGAAGCCTTTGCCGAAACCTATCCACAACTCATCCCAATGTCGGAACAAGAACCAGCGGAACTCATCGAGGCAGTTACCTCCGCTCTCGGTCACGTTGATGTACTTGTGAGCAACGACATCGCTCCGGTCGAGTGGCGCCCAATCGATAAATACGCTGTAGAGGACTATCGCGATACTGTCGAGGCGCTCCAAATTAAGCCATTTGCACTGGTCAACGCCGTTGCAAGTCAAATGAAGAAGCGCAAAAGCGGACATATTATCTTTATTACCTCTGCTGCTCCAGTTGGGCCTTGGAAGGAACTTTCTACCTACTCGTCAGCCCGTGCAGGTGCATCTGCTTTGGCAAATGCCCTTTCGAAGGAACTCGGTGAATACAACATTCCGGTGTTCGCAATCGCTCCA...

Embodiment 2

[0058] Example 2 Construction and Induced Expression of Genetically Engineered Bacteria

[0059] The expression host Escherichia coli BL21(DE3) was transformed with the plasmid pET30-HHDH constructed in Example 1. Use primers F_HHDH / R_HHDH for colony PCR to verify transformed recombinants. The verified genetically engineered bacteria is EcoH. EcoH was inoculated into the fermentation medium and cultured with constant temperature shaking for 16 hours. The culture conditions were 35° C. and 180 rpm. When the cell concentration grows to OD 600 When =0.8, add 0.4mM IPTG (final concentration) and induce at 16°C for 20h.

Embodiment 3

[0060] Example 3 Construction and Induced Expression of Genetically Engineered Bacteria

[0061] The expression host Escherichia coli BL21(DE3) was transformed with the plasmid pET30-HHDH constructed in Example 1. Use primers F_HHDH / R_HHDH for colony PCR to verify transformed recombinants. The verified genetically engineered bacteria is EcoH. EcoH was inoculated into the fermentation medium and cultured with constant temperature shaking for 16 hours. The culture conditions were 40° C. and 220 rpm. When the cell concentration grows to OD 600 When =1.2, add 0.8mM IPTG (final concentration) and induce at 22°C for 20h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering bacterium and a method for preparing tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate. The engineering bacterium comprises a host cell and a target gene transformed into the host cell, wherein the target gene is a halohydrin dehalogenase gene. The method comprises the following steps: culturing the engineering bacterium and inducing the halohydrin dehalogenase gene to express; centrifuging to take the cell; resuspending by a buffer liquid to obtain a resting cell suspension; adding tert-butyl (3R, 5S) 6-chloro-3, 5-dyhydroxyl hexanoate and NaCN to the resting cell suspension for reacting, and after reaction, separating and purifying a reaction liquid to obtain a product. Through the catalytic effect of the enzyme, the method disclosed by the invention simplifies the production process of tert-butyl (3R, 5R) 6-cyan-3, 5-dyhydroxyl hexanoate, is free from a lot of reaction byproducts and lowers the production cost.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and in particular relates to an engineering bacterium and a method for preparing (3R, 5R) 6-cyano-3, 5-dihydroxyhexanoic acid tert-butyl ester by using the engineering bacterium. Background technique [0002] Statins are a class of competitive enzyme inhibitors of hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase, and are also the main blood lipid-lowering drugs. HMG-CoA reductase catalyzes the reduction of HMG-CoA to 3-methyl-3,5-dihydroxyvaleric acid, which is the biosynthesis pathway of cholesterol. Statins can inhibit cholesterol in vivo by inhibiting the synthesis of HMG-CoA reductase Synthesis of free cholesterol, thereby reducing the level of free cholesterol in cells, feedback up-regulation of the expression of low-density lipoprotein receptors on the cell surface, promoting the removal of very low-density lipoprotein cholesterol residues and low-density lipoprotein in circulating blo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/00C12R1/19
Inventor吴坚平陈少云何秀娟杨立荣徐刚
OwnerZHEJIANG UNIV