A method for producing 1,3-propanediol with high efficiency and high conversion rate

A high conversion rate, propylene glycol technology, applied in the field of bioengineering, can solve the problems of 3-hydroxypropionic acid accumulation, difficulty, and small production promotion effect, and achieve the effect of high production intensity, high product concentration and high conversion rate

Active Publication Date: 2017-09-15
EAST CHINA UNIV OF SCI & TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the overexpression of 1,3-oxidoreductase has little effect on the production of 1,3-PD, and the overexpression of 3-formyl propionaldehyde dehydrogenase will cause the accumulation of 3-hydroxypropionic acid (3-HP). It is difficult to obtain high 1,3-PD yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for producing 1,3-propanediol with high efficiency and high conversion rate
  • A method for producing 1,3-propanediol with high efficiency and high conversion rate
  • A method for producing 1,3-propanediol with high efficiency and high conversion rate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The identification of embodiment 1, KG

[0030] The physical and chemical indicators of KG were analyzed with the Gram-negative intestinal microorganism physicochemical kit API20E (Mérieux, France). The physical and chemical identification steps are based on the API20E operation manual, and the identification results are shown in Table 1. According to the API20E manual, KG belongs to Klebsiella pneumoniae.

[0031] Table 1: API20E physical and chemical identification results

[0032]

[0033] The bacterial 16srDNA universal primers 27f (AGAGTTTGATCCTGGCTCA) and 1394r (TACGGCTACCTTGTTACGAGTT) were used to amplify the 16srNDA gene of KG by PCR using the KG genome as a template. The homologous comparison of 16srNDA showed that KG belongs to Klebsiella pneumoniae (attached figure 1 ).

Embodiment 2

[0034] Embodiment 2, KG can produce 1,3-PD with high conversion rate

[0035] Put KG and the control bacterium K.pneumoniae ATCC49790 into a 250ml shaker flask (50ml liquid volume) for seed cultivation for 20 hours, and then put it into a 5L fermenter (2L liquid volume of the fermentation broth), according to the process shown below Conditions control the fermentation process.

[0036] The initial glycerol concentration is 60g / L, the fermentation temperature is 35°C; the ventilation rate is 1.0vvm; the stirring speed is 20rpm; the pH value is controlled by adding NaOH solution to 5.5-7.5 during the fermentation process. In each period of fermentation, the glycerin concentration is controlled at 10-60 g / L by supplementing glycerin solutions with different concentrations, and the fermentation ends in 30 hours.

[0037] Shown in fermentation result table 2:

[0038] Table 2: Fermentation comparison of KG and ATCC49790

[0039]

[0040] It can be seen from Table 2 that compare...

Embodiment 3

[0041] Embodiment 3, construction contains the expression plasmid of moderate expression promoter Tac

[0042] The backbone of the expression vector was pET28a, and the Tac promoter sequence was pGEX-4T-1. Using a pair of primers containing the BglII-EcoRI restriction site (GGAagatctACGTTATCGACTGCACGG, GGCgaattcCATGAATACTGTTTCCTGT), the Tac promoter region 260bp (SEQ ID NO.2) on pGEX-4T-1 was amplified and inserted into the BglII-EcoRI of pET28a Restriction sites were used to replace the original T7 promoter region of pET28a to construct an expression vector pETac capable of moderate gene expression in Klebsiella.

[0043] In order to prove that pETac can moderately express genes in Klebsiella pneumoniae, a reporter gene (lacZ) was used to analyze the promoter Tac. lacZ (the gene encoding galactosidase) was derived from Escherichia coli. A pair of primers containing HindIII-XhoI (CACaagcttGCGTTTTACAACGTCGTGAC, CCGctcgagTTATTTTTGACACCAGACCA) was used to amplify the 3075bp lac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing 1,3-propanediol by converting glycerol through klebsiella pneumoniae having the preservation number of CCTCC NO: M2014574. The method comprises the following steps of carrying out seed culture and converting glycerol into 1,3-propanediol by fermenting in a fermentation tank. The klebsiella pneumonia has high conversion efficiency. Furthermore, by appropriately strengthening a metabolic pathway of 3-hydroxypropionic acid of the klebsiella pneumoniae, the accumulation of 3-hydroxy propanal is solved and meanwhile, the excessive accumulation of a by-product 3-hydroxypropionic acid is avoided and thus the efficient conversion of 1,3-propanediol is achieved. Compared with the method disclosed by the prior art, the method has the main advantages of high concentration of the product, large production intensity and high conversion rate.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, in particular, relates to a kind of high-efficiency and high-conversion production of 1, 3-propanediol method. Background technique [0002] 1,3-Propanediol (1,3-porpanediol, referred to as 1,3-PD) is an important chemical raw material, which can be used as a solvent, antifreeze or protective agent, fine chemical raw material and a new type of polyesterpolyester Monomer of propylene glycol phthalate (PTT) and polyurethane. PTT has been proved to be a new type of polyester material with excellent performance. At present, 1,3-PD production mainly adopts biosynthesis. The main route of biosynthesis is to convert glycerol into 1,3-PD under the action of microorganisms. At present, the microorganisms capable of converting glycerol into 1,3-PD in nature roughly include: Klebsiela pneumoniae, Citrobacter freundi, Clostridium butyricum and the like. [0003] Studies have shown that Klebsiell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P7/18C12R1/22
CPCC12P7/18
Inventor宫衡朱成前傅水林
OwnerEAST CHINA UNIV OF SCI & TECH