Immunomagnetic bead substrate color development test paper and preparation method thereof

An immunomagnetic bead and substrate technology, applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of detachment of antibodies or labeled proteins, reduction of antibody amount, and sensitivity reduction, etc., to achieve rapid response, simple operation, and low cost. Effect

Active Publication Date: 2015-03-11
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, some immunological detection methods, such as the detection of antibodies against some viral pathogens, are mainly ELISA detection methods, chemiluminescence and other methods. ELISA detection methods require washing and clapping. The operation is cumbersome, and a detection instrument is required to measure the absorbance value. Judging the test results; chemiluminescence method, the reagents used are expensive, and the result judgment also requires expensive instruments to detect the fluorescence value, and requires the testing personnel to have certain professional qualities
[0003] Existing rapid detection methods are simple to operate. For example, although the colloidal gold detection method does not require special equipment and reagents, the result judgment is intuitive, the technical level of the detection personnel is not high, and it is suitable for on-site detection. However, colloidal gold can bind antigen or antibody. Finally, it is very unstable, and it is easy to detach the antibody or labeled protein due to the change of charge, resulting in a greatly reduced amount of labeled antibody per colloidal gold, resulting in a decrease in sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunomagnetic bead substrate color development test paper and preparation method thereof
  • Immunomagnetic bead substrate color development test paper and preparation method thereof
  • Immunomagnetic bead substrate color development test paper and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Preparation of forest encephalitis antigen

[0057] The specific steps for preparing the recombinant antigen of forest encephalitis antibody are as follows:

[0058] a. Construction of recombinant plasmids

[0059] Referring to the nucleotide sequence of forest encephalitis (TBE) outer membrane protein (GenBank sequence number: gbHM133639.1), the gene sequence was modified according to the preferred codons of Escherichia coli O127:H6, and the secondary structure of the recombinant protein was analyzed by bioinformatics Screened and verified by multiple experiments, the finally determined gene sequence is shown in SEQ ID NO.1.

[0060] SEQ ID NO.1:

[0061] GGTTTGACCTACACCATGTGCGACAAAACCAAGTTCACCTGGAAGCGTATCCCTACCGACTCTGGTCACGACACCGTTGTTATGGAAGTTGCTTTCTCTGGTACCAAGCCATGTCGTATCCCTGTTCGTGCTGTTGCTCACGGTTCTCCTGACGTTAACGTTGCTATGCTGATGACCCCAAACCCAACCATCGAAAACAACGGTGGTGGTTTCATCGAAATGCAACTGCCACCAGGTGACAACATCATCTACGTTGGTGAATTGTCTCACCAGTGGTTCCAGAAGGGTTCTTCTATCGGT

[0062] Entrus...

Embodiment 2

[0068] Preparation of magnetic nanoparticle immunochromatographic test strips for forest encephalitis antibodies

[0069] A. SPA labeling magnetic nanoparticles, and preparing magnetic nanoparticle carrier pads:

[0070] Take 100 μl Fe 3 o 4 Magnetic nanoparticle solution (preferably, Fe 3 o 4 The particle size of magnetic nanoparticles is 12nm), add 700 μl water, 200 μl 25% glutaraldehyde solution, shake for 3 hours; wash 1-2 times with 1ml water, wash twice in PBS; add 500 μl, 2mg / ml SPA, shake for 3 hours, pH value is 7.6; add 500 μl, 0.5% BSA, shake for 30 minutes to block; add 0.01% Tween-20 in 0.01M PBS, wash 3-4 times; add 1mL resuspension solution, which Containing 0.1% by weight of Tris base, 1% of BSA and 5% of sucrose, mixed evenly, sprayed on the glass fiber membrane, and dried at 37°C for 4h;

[0071] B, coated nitrocellulose membrane: the forest encephalitis recombinant antigen prepared in Example 1 and goat anti-rabbit IgG were diluted to 1 mg / mL and 0.8 mg...

Embodiment 3

[0077] Sensitivity Detection of Immunochromatographic Test Paper with Nano-magnetic Beads and Colloidal Gold Antibody for Forest Encephalitis Antibody

[0078] With the test strip prepared in embodiment 2, and the colloidal gold immunochromatography test paper made by the same antigen antibody as the Institute of Health and Quarantine of China Inspection and Quarantine Science Research Institute, detect forest encephalitis antibody serum respectively, and be diluted to 1 with fetal bovine serum: 10. 1:100, 1:1000, 1:10000, 1:100000, 1:1000000, at the same time, take fetal bovine serum as a negative control, take 80 μL of serum sample into the sample hole, and take 50 μL of TMB chromogenic solution after 2 minutes Drop it on the sample pad, judge the result after 10 minutes, and compare the sensitivity of the nano-magnetic bead immunochromatography test strip and the colloidal gold immunochromatography test strip.

[0079] Test results such as Figure 4 (the detection result f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to view more

Abstract

The invention discloses immunomagnetic bead substrate color development test paper and a preparation method thereof, and belongs to the field of biological detection reagent. The test paper includes a sample pad, an Fe3O4 magnetic nanoparticle carrier pad, a nitrocellulose membrane and an absorbent pad which are successively overlapped and are pasted on a bottom lining card; the Fe3O4 magnetic nanoparticle carrier pad is a glass fiber membrane fixed with an SPA labeled magnetic nanoparticle carrier; the nitrocellulose membrane is provided with a detection band coated with a to-be-detected item antigen and a quality control band coated with an antibody IgG which can be combined with an SPA specific antibody. The invention also discloses a preparation method of the test paper strip; the test paper strip is used for detection of the to-be-detected item antigen, the operation is simple, the sample can be detected without special instruments and technical personnel professional training, response is rapid, result detection can be completed in 10 min at the soonest, test results can be judged by visual inspection, the detection sensitivity is high, and the detection sensitivity is increased more than 100 times that of a conventional colloidal gold method.

Description

technical field [0001] The invention relates to the field of biological detection reagents, in particular to an immunomagnetic bead substrate color test paper and a preparation method thereof. Background technique [0002] At present, some immunological detection methods, such as the detection of antibodies against some viral pathogens, are mainly ELISA detection methods, chemiluminescence and other methods. ELISA detection methods require washing and clapping. The operation is cumbersome, and a detection instrument is required to measure the absorbance value. Judging the test results; chemiluminescence method, the reagents used are expensive, and the result judgment also requires expensive instruments to detect the fluorescence value, and requires the testing personnel to have certain professional qualities. [0003] Existing rapid detection methods are simple to operate. For example, although the colloidal gold detection method does not require special equipment and reagen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/569
CPCG01N33/56983
Inventor 杨宇王静赵婷婷徐宝梁
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap