Cyanea capillata serine proteinase inhibitor as well as coded gene and application thereof

A technology of serine protease and hair-shaped jellyfish, which is applied in the field of biomedicine, can solve problems such as no research report on jellyfish Kazal-type serine protease inhibitor, etc., and achieves remarkable serine protease activity, good application prospect, and enhanced growth inhibitory effect. Effect

Active Publication Date: 2015-05-20
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there are no relevant research reports on jellyfish Kazal-type serine protease inhibitors at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyanea capillata serine proteinase inhibitor as well as coded gene and application thereof
  • Cyanea capillata serine proteinase inhibitor as well as coded gene and application thereof
  • Cyanea capillata serine proteinase inhibitor as well as coded gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Screening and sequence analysis of jellyfish serine protease inhibitors

[0059] 1) The extraction of total RNA from the tentacles of A. phagina jellyfish was carried out according to the instructions of the Trizol kit from Invitrogen, and the protein was removed with chloroform to obtain about 7 μg of total RNA;

[0060] 2) The isolation of mRNA was carried out according to the instructions of Oligotex mRNA Spin-column Kit of QIANGEN Company, and the synthesis of cDNA was carried out according to the instructions of SMART cDNA Library Construction Kit of Clontech Company;

[0061]3) Insert the cDNA into the pUC19 plasmid vector (purchased from Takara Company), and then transform it into Escherichia coli DH5α (purchased from Beijing Bomaide Company), spread it on a 15cm petri dish for blue-white screening, and then form the tentacles of jellyfish jellyfish Tissue cDNA library.

[0062] The library has a total of 1923 colonies, including 35 coeruleus, a recom...

Embodiment 2

[0064] Example 2: Construction of a recombinant expression plasmid for Aequosia habilis serine protease inhibitors and recombination of engineering bacteria

[0065] 1) A pair of primers were designed and synthesized according to the sequence of the serine protease inhibitor gene sequence of A. jellia habilis and the restriction site of the prokaryotic expression vector pGEX-6P-1 (purchased from Novagen), wherein the upstream primer contains the restriction site EcoR I (GAATTC), the downstream primer contains restriction site XhoI (CTCGAG), the sequences of the two primers are as follows:

[0066] Upstream primer: 5'CGGAATTCATGACCAAGCCATT 3' (SEQ ID NO:3)

[0067] Downstream primer: 5'CCGCTCGAGTTTTCTGCATTG 3'(SEQ ID NO:4)

[0068] After the gradient PCR experiment, 55.5°C was selected as the optimal annealing temperature, and the target gene was amplified by PCR. The PCR reaction conditions were: 95°C for 5 min; 95°C for 30 sec, 55.5°C for 30 sec, 68°C for 1 min, 38 cycles; ...

Embodiment 3

[0071] Example 3: Expression of Serine Protease Inhibitors from Aequorea habilis

[0072] Add the recombinant Escherichia coli Rosetta (DE3).pLysS bacterial liquid with correct sequencing to the liquid LB medium containing ampicillin (100 μg / ml) and chloramphenicol (34 μg / ml), and cultivate it to OD at 37 ° C and 250 rpm on a shaker 600 When it was 0.6-0.8, the inducer IPTG was added for induction.

[0073] The optimal expression condition of the recombinant protein was determined as follows: induction at 12° C., 1 mM IPTG, and 150 rpm for 7 hours. After induction, the bacteria were collected by centrifugation, and the recombinant protein could be expressed in a soluble form under the induction conditions by SDS-PAGE electrophoresis, and the molecular weight was consistent with the predicted value (about 45kDa after adding the GST tag), as shown in image 3 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological medicines, provides a cyanea capillata Kazal serine proteinase inhibitor as well as a preparation method thereof, and aims at solving the problem that no reports up to now are related to the study on medusa Kazal serine proteinase inhibitors. The cyanea capillata serine proteinase inhibitor has the protein with the amino acid sequence shown as SEQ ID NO: 2. The invention further provides a coded gene of the cyanea capillata serine proteinase inhibitor, wherein the coded gene has the nucleotide sequence shown as SEQ ID NO: 1. The invention further provides an application of the cyanea capillata serine proteinase inhibitor as well as the coded gene in application in preparation of antibacterial drugs, inflammatory drugs and skin protectants.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to a jellyfish serine protease inhibitor and its coding gene and application. Background technique [0002] The ocean is a treasure house of biological resources, and more than 80% of the species in the world are stored in the ocean. Due to long-term living in the special marine ecological environment of high salinity, high pressure and anoxic environment, the physiological structure and metabolites of marine organisms are different from those of land organisms, and they produce and accumulate a large number of substances with special chemical structures, special physiological activities and functions. An important resource for the development of new marine medicines. Marine biological resources mainly include marine biotoxins, physiologically active substances, biological information substances and biological functional materials. Marine bioactive substances are an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/81C12N15/15A61K48/00A61K38/55A61P31/04A61P29/00A61P17/16
CPCA61K38/57C07K14/811
Inventor张黎明柳国艳周永红贺茜王倩倩王蓓蕾刘丹张慧成熙
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY