Microsporidia met‑ap2 gene of Bombyx mori and its application
A technology for microsporidia and silkworm, which can be applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of low primer sensitivity and false positives, and achieve the effects of good detection sensitivity, accurate screening and time saving.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Cloning of the Met-AP2 gene of Bombyx mori Nos.
[0049] 1. Primer design
[0050] Based on the genome analysis data, the Met-AP2 gene of other species was analyzed, and combined with various microsporidian genomes for homology analysis, a pair of primers MC-F / MC-R was designed through the primer design software Primer5.0. The primer sequences are as follows:
[0051] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;
[0052] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.
[0053] 2. PCR amplification
[0054] The DNA and cDNA of Bombyx mori were respectively used as templates, and primers MC-F / MC-R were used for PCR amplification. The reaction system and reaction procedure were as follows:
[0055] The PCR reaction system (total volume 20 μL):
[0056] 2×Taq Master Mix (reaction buffer) 10μL
[0057] 10 μM upstream primer 0.5 μL
[0058] 10 μM downstream primer 0.5 μL
[0059] Template DNA 1 μL;
[0060] wxya 2 O to m...
Embodiment 2
[0068] Example 2 Detection primer design and establishment of PCR amplification method
[0069] 1. Primer design
[0070] (1) On the basis of obtaining the Met-AP2 gene of No. silkworm, 14 pairs of primers were designed using Primer premier 5.0 software. The sequences of each set of primers are as follows:
[0071] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;
[0072] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.
[0073] Upstream primer 2047-F (SEQ ID NO.6): GGAGAAGGGTGATGGAATAG;
[0074] Downstream primer 2047-R (SEQ ID NO. 7): CGACGGTAGATAACCACATA.
[0075] Upstream primer M6-F (SEQ ID NO.8): CCCCTAAATGAGGCC;
[0076] Downstream primer M6-R (SEQ ID NO.9): CCTATTCCATCACCCT.
[0077] Upstream primer M7-F (SEQ ID NO.10): CCCCTAAATGAGGCC;
[0078] Downstream primer M7-R (SEQ ID NO.11): TGGAAGCACGGTAAA.
[0079] Upstream primer M8-F (SEQ ID NO.12): TTTCTGCTCCCCTAAA;
[0080] Downstream primer M8-R (SEQ ID NO. 13): TTCCATCACCCTTCTC. ...
Embodiment 3
[0116] Example 3 Primer Specific Detection
[0117]1. Take No. silkworm, No. mulberry borer, No. mulberry looper, No. litura, No. xylostella, No. rapae, No. tussah, No. zhejiang worm, No. corn borer or No. megasporosa Shandong as templates, using the PCR method of Example 2, the detection specificity of the 7 pairs of primers screened in Example 2 was studied.
[0118] 2. The results showed that only five pairs of primers, MC-F and MC-R, 2047-F and 2047-R, M5-F and M5-R, M6-F and M6-R, M7-F and M7-R, could There are many types of microsporidia detected, and 7, 6, 5, 5 and 4 types of microsporidia can be detected respectively. Specific as attached Figure 3-6 shown.
[0119] Among them, MC-F and MC-R detect the most types of microsporidia, and can simultaneously detect No. There are 7 common main microsporidia in mulberry gardens, including microsporidia, microsporidium rapae and microsporidium tussah, which have the best detection versatility and have a good application pr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


