Microsporidia met‑ap2 gene of Bombyx mori and its application

A technology for microsporidia and silkworm, which can be applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of low primer sensitivity and false positives, and achieve the effects of good detection sensitivity, accurate screening and time saving.

Active Publication Date: 2017-12-26
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the target genes designed for the PCR detection technology of silkworm microsporidia are SSU rRNA, and the primers designed for other microsporidian genes are less or have poor sensitivity, so they are rarely reported
Baker et al (1995) and Terry et al (1999) designed PCR primer V1f / 530r based on the highly conserved region of SSU rRNA of similar species of Microsporidia, which can identify DNA templates of various species of Microsporidia and amplify about 450bp Specific purpose bands, but often have problems such as false positives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microsporidia met‑ap2 gene of Bombyx mori and its application
  • Microsporidia met‑ap2 gene of Bombyx mori and its application
  • Microsporidia met‑ap2 gene of Bombyx mori and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Cloning of the Met-AP2 gene of Bombyx mori Nos.

[0049] 1. Primer design

[0050] Based on the genome analysis data, the Met-AP2 gene of other species was analyzed, and combined with various microsporidian genomes for homology analysis, a pair of primers MC-F / MC-R was designed through the primer design software Primer5.0. The primer sequences are as follows:

[0051] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;

[0052] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.

[0053] 2. PCR amplification

[0054] The DNA and cDNA of Bombyx mori were respectively used as templates, and primers MC-F / MC-R were used for PCR amplification. The reaction system and reaction procedure were as follows:

[0055] The PCR reaction system (total volume 20 μL):

[0056] 2×Taq Master Mix (reaction buffer) 10μL

[0057] 10 μM upstream primer 0.5 μL

[0058] 10 μM downstream primer 0.5 μL

[0059] Template DNA 1 μL;

[0060] wxya 2 O to m...

Embodiment 2

[0068] Example 2 Detection primer design and establishment of PCR amplification method

[0069] 1. Primer design

[0070] (1) On the basis of obtaining the Met-AP2 gene of No. silkworm, 14 pairs of primers were designed using Primer premier 5.0 software. The sequences of each set of primers are as follows:

[0071] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;

[0072] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.

[0073] Upstream primer 2047-F (SEQ ID NO.6): GGAGAAGGGTGATGGAATAG;

[0074] Downstream primer 2047-R (SEQ ID NO. 7): CGACGGTAGATAACCACATA.

[0075] Upstream primer M6-F (SEQ ID NO.8): CCCCTAAATGAGGCC;

[0076] Downstream primer M6-R (SEQ ID NO.9): CCTATTCCATCACCCT.

[0077] Upstream primer M7-F (SEQ ID NO.10): CCCCTAAATGAGGCC;

[0078] Downstream primer M7-R (SEQ ID NO.11): TGGAAGCACGGTAAA.

[0079] Upstream primer M8-F (SEQ ID NO.12): TTTCTGCTCCCCTAAA;

[0080] Downstream primer M8-R (SEQ ID NO. 13): TTCCATCACCCTTCTC. ...

Embodiment 3

[0116] Example 3 Primer Specific Detection

[0117]1. Take No. silkworm, No. mulberry borer, No. mulberry looper, No. litura, No. xylostella, No. rapae, No. tussah, No. zhejiang worm, No. corn borer or No. megasporosa Shandong as templates, using the PCR method of Example 2, the detection specificity of the 7 pairs of primers screened in Example 2 was studied.

[0118] 2. The results showed that only five pairs of primers, MC-F and MC-R, 2047-F and 2047-R, M5-F and M5-R, M6-F and M6-R, M7-F and M7-R, could There are many types of microsporidia detected, and 7, 6, 5, 5 and 4 types of microsporidia can be detected respectively. Specific as attached Figure 3-6 shown.

[0119] Among them, MC-F and MC-R detect the most types of microsporidia, and can simultaneously detect No. There are 7 common main microsporidia in mulberry gardens, including microsporidia, microsporidium rapae and microsporidium tussah, which have the best detection versatility and have a good application pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention discloses the silkworm microsporidia Met-AP2 gene and its application in the detection of microsporidia, as well as a set of universal detection primers and kits for microsporidia. Described universal detection primer comprises upstream primer MC-F and downstream primer MC-R, and the nucleotide sequence of upstream primer MC-F is as shown in SEQ ID NO.4, and the nucleotide sequence of downstream primer MC-R is as in SEQ ID Shown in NO.5. The detection primer uses the gene Met-AP2 as the target gene, and can be applied to the detection of various microsporidia at the same time. The early detection of insects has important practical significance.

Description

technical field [0001] The invention belongs to the field of biotechnology. More specifically, it relates to the Met-AP2 gene of Bombyx mori and its application. Background technique [0002] The pathogen of silkworm microsporidiosis is a kind of intracellular obligate parasitic eukaryote, which has been classified as a protozoa before, and has been classified as a fungus in recent years. Because of its characteristics of vertical transmission, it has become the most concerned one among the pathogenic microorganisms of silkworm, and it is also the only epidemic disease in the pathogenic microorganisms of silkworm under legal quarantine. From the discovery in the 19th century to the present, the silkworm microsporidiosis has caused huge losses to the sericulture industry in various countries. In addition, other different microsporidia can also attack other insects such as bees and locusts, aquatic products such as fish, mammals such as rabbits and dogs, and even humans, cau...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/30C07K14/44C12Q1/68C12Q1/04
CPCC12Q1/68C12N1/105C12R2001/90Y02A50/30
Inventor 刘吉平杨思佳
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap