Multi-site mutant strain of phytase gene of Torula delbrueckii and its application

A technology of multi-site mutation and Torula spores, which is applied in plant gene improvement, application, genetic engineering, etc., can solve the problems of unfavorable phytase hydrolysis of phytic acid and low enzyme activity

Active Publication Date: 2019-12-20
ANHUI SCI & TECH UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the optimum pH for most phytase activity is 4.5 to 5, and at pH 2 to 3, the enzyme activity is relatively low, only 30-40% of the optimum pH condition, which is not conducive to the hydrolysis of phytase in the gastric environment Phytic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-site mutant strain of phytase gene of Torula delbrueckii and its application
  • Multi-site mutant strain of phytase gene of Torula delbrueckii and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, the primary screening of high phytase activity mutant strain

[0028] First, carry out ultraviolet mutagenesis on the yeast strains. Spread Torula delbrueckii on a calcium phytate plate and irradiate with a 15W ultraviolet lamp for 30-90s, then cover the dish, and place it upside down in a constant temperature incubator at 30°C to avoid light. Cultivate for 2 to 3 days, pick a single yeast colony with a larger diameter of the hydrolytic transparent circle in the plate and inoculate it on another calcium phytate plate, culture for 3 to 4 days, measure the diameter of the hydrolytic transparent circle (H) and the diameter of the colony ( C), Calculate the ratio of the diameter of the hydrolytic transparent circle to the diameter of the colony (H / C), compare the H / C value with the control group, and screen out the mutant strain with a larger H / C value. Then spot the screened mutant yeast strains and control strains on a calcium phytate plate, spot three paral...

Embodiment 2

[0029] Embodiment 2, the double screening of phytase high activity mutant strain under the acidic environment

[0030] Inoculate the yeast mutant strains and control yeast strains with large H / C values ​​screened out through mutagenesis treatment into 250mL Erlenmeyer flasks containing 50mL liquid YPD medium, respectively, and culture them with shaking at 30°C and 160r / min for 36h, then use Centrifuge in a high-speed refrigerated centrifuge (4°C, 4000r / min, centrifuge for 10min) to take the fermentation supernatant, and analyze the phytase under the entire acidic condition at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5 active. Under these pH conditions, the phytase activity of the mutant yeast strains was greater than that of the control yeast strains.

Embodiment 3

[0031] Embodiment 3, the synthesis of yeast phytase gene

[0032] According to the sequence of the yeast phytase gene, the 5' end of the PCR primer contains not I endonuclease site, 3' end contains EcoR I endonuclease site, the primer sequence is as follows:

[0033] 5' primer TDphyFor: CCGGAATTCATGCTTTGGGAAAAAATTGGTACTCAGG

[0034] 3' Primer TDphyRev: TAGCGGCCGCTTATTTTTTGATCAAACTAGCGT

[0035] The yeast phytase gene can be synthesized by using the phytase gene as a template and carrying out PCR amplification with the above primers. Plasmid DNA of positive clones was taken for gene sequencing.

[0036] The sequencing results confirmed that the 913th base A of the mutant phytase gene sequence was mutated to C, the 936th base T was mutated to C, the 1117th base G was mutated to A, and the 1193rd base A was mutated It is G; the mutation site of the encoded amino acid sequence is that Lys at position 305 is mutated to Gln, Val at position 373 is mutated to Ile, and Lys at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phytase gene multisite mutant strain of Deshi spore torula yeast and application of the phytase gene multisite mutant strain and relates to the technical field of biology. According to the phytase gene multisite mutant strain disclosed by the invention, the yeast is subjected to ultraviolet mutation to mutate a phytase gene to obtain a high-activity phytase gene mutant strain of which three amino acid sites are mutated; the high-activity phytase gene mutant strain has quite high phytic acid hydrolysis activity in an overall acidic environment and satisfies the requirement of well hydrolyzing phytic acid at a pH condition of a stomach environment. The strain can be used for producing phytase which is used as a feed or a food and can also be used for producing a microbial phosphatic fertilizer and (or) a biological organic phosphatic fertilizer; the preservation number of the strain is CGMCC No.8738. The mutated phytase gene sequence can be cloned on a pronucleus and (or) eukaryon biological gene expression vector, and a genetic engineering strain and (or) transgenic plants can be built by a genetic engineering technology, so that the phytase gene can be efficiently expressed to produce phytase.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular, the invention relates to an optimized and improved Torula delbrueckii mutant strain with improved catalytic activity of phytase PHY-M in the acid range and its multi-site mutant phytase gene phy -m and apply. Background technique [0002] Phytate (Phytate, Phytic acid, IP6), also known as phytic acid, contains 6 phosphate groups and is an important storage form of phosphorus in feed. Phosphorus is an essential mineral element for animals, but monogastric animals lack phytase (Phytase, an enzyme that catalyzes the hydrolysis of phytic acid and phytate) in the body of monogastric animals, resulting in only 1 / 3 or more of the utilization rate of phosphorus in feed Low. In order to supplement the deficiency of available phosphorus, inorganic phosphate must be added to the feed, commonly used as calcium hydrogen phosphate and bone meal. This not only greatly increases the cost of feed, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/19C12N15/55C12N9/16C12N15/81C12N15/82C12R1/88
CPCC12N9/16
Inventor马忠友邢素芝汪建飞赵建荣王德生骆云飞
OwnerANHUI SCI & TECH UNIV