Multi-site mutant strain of phytase gene of Torula delbrueckii and its application
A technology of multi-site mutation and Torula spores, which is applied in plant gene improvement, application, genetic engineering, etc., can solve the problems of unfavorable phytase hydrolysis of phytic acid and low enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1, the primary screening of high phytase activity mutant strain
[0028] First, carry out ultraviolet mutagenesis on the yeast strains. Spread Torula delbrueckii on a calcium phytate plate and irradiate with a 15W ultraviolet lamp for 30-90s, then cover the dish, and place it upside down in a constant temperature incubator at 30°C to avoid light. Cultivate for 2 to 3 days, pick a single yeast colony with a larger diameter of the hydrolytic transparent circle in the plate and inoculate it on another calcium phytate plate, culture for 3 to 4 days, measure the diameter of the hydrolytic transparent circle (H) and the diameter of the colony ( C), Calculate the ratio of the diameter of the hydrolytic transparent circle to the diameter of the colony (H / C), compare the H / C value with the control group, and screen out the mutant strain with a larger H / C value. Then spot the screened mutant yeast strains and control strains on a calcium phytate plate, spot three paral...
Embodiment 2
[0029] Embodiment 2, the double screening of phytase high activity mutant strain under the acidic environment
[0030] Inoculate the yeast mutant strains and control yeast strains with large H / C values screened out through mutagenesis treatment into 250mL Erlenmeyer flasks containing 50mL liquid YPD medium, respectively, and culture them with shaking at 30°C and 160r / min for 36h, then use Centrifuge in a high-speed refrigerated centrifuge (4°C, 4000r / min, centrifuge for 10min) to take the fermentation supernatant, and analyze the phytase under the entire acidic condition at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5 active. Under these pH conditions, the phytase activity of the mutant yeast strains was greater than that of the control yeast strains.
Embodiment 3
[0031] Embodiment 3, the synthesis of yeast phytase gene
[0032] According to the sequence of the yeast phytase gene, the 5' end of the PCR primer contains not I endonuclease site, 3' end contains EcoR I endonuclease site, the primer sequence is as follows:
[0033] 5' primer TDphyFor: CCGGAATTCATGCTTTGGGAAAAAATTGGTACTCAGG
[0034] 3' Primer TDphyRev: TAGCGGCCGCTTATTTTTTGATCAAACTAGCGT
[0035] The yeast phytase gene can be synthesized by using the phytase gene as a template and carrying out PCR amplification with the above primers. Plasmid DNA of positive clones was taken for gene sequencing.
[0036] The sequencing results confirmed that the 913th base A of the mutant phytase gene sequence was mutated to C, the 936th base T was mutated to C, the 1117th base G was mutated to A, and the 1193rd base A was mutated It is G; the mutation site of the encoded amino acid sequence is that Lys at position 305 is mutated to Gln, Val at position 373 is mutated to Ile, and Lys at...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

