Application of DLK1 gene in preparation of gastrointestinal stromal tumor diagnostic reagent

A gastrointestinal stromal tumor, gene technology, applied in the field of biomedicine, can solve the problems of increasing drug resistance, high price, waste of medical resources and so on

Active Publication Date: 2015-06-17
SHANGHAI INST OF ONCOLOGY
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are also some problems in the clinical practice of targeted drug therapy: (1) about 5-10% of patients are primary resistant to imatinib, and most of the patients who are effective to initial treatment with imatinib Patients will inevitably develop drug resistance eventually, and drug resistance mostly occurs within 6 months to 2 years after the initiation of initial treatment; (2) Currently, patients with high recurrence risk of GIST receive adjuvant imatinib therapy for a certain period of time after surgery. Consensus has been reached, however, the selection of the appropriate population for adjuvant therapy has always been controversial. Relaxing the indications for treatment will inevitably lead to a waste of medical resources and increase the occurrence of drug resistance; excessively strict indications will also cause some patients to miss the reasonable treatment they should receive (3) The high price of imatinib discourages many patients. If there are more objective and reasonable indicators for judging the recurrence risk of GIST patients, it will greatly benefit the rational allocation of medical resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DLK1 gene in preparation of gastrointestinal stromal tumor diagnostic reagent
  • Application of DLK1 gene in preparation of gastrointestinal stromal tumor diagnostic reagent
  • Application of DLK1 gene in preparation of gastrointestinal stromal tumor diagnostic reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1, gastrointestinal stromal tumor

[0059] The inventor first selected 12 cases of fresh surgically resected specimens of gastric GIST, and according to the currently used international GIST risk NIH grading standard (considering tumor size and mitotic phase), the specimens were numbered according to the increasing risk of tumor recurrence (low-risk 4 cases , 4 cases of medium risk, and 4 cases of high risk). The NimbleGen chip of Roche Company was used to study the gene expression profile microarray of the 12 samples, and the genes that were significantly up-regulated or down-regulated with the increase of tumor risk among different risk groups were screened out (p2).

[0060] The results were screened to obtain a part of the genes whose expression occurred. It is particularly noteworthy that: in the expression profile microarray, the DLK1 gene was significantly up-regulated with the increase of tumor risk, p=0.00032, and the fold change of high risk vs. lo...

Embodiment 2

[0061] Example 2. Real-time quantitative PCR analysis of DLK1 gene expression in high-risk and low-risk patients with gastrointestinal stromal tumors

[0062] The genes screened above were verified by real-time quantitative PCR in another 24 GIST fresh tumor samples (14 high-risk cases and 10 low-risk cases).

[0063] 1.1 Main reagents

[0064] The RNA extraction reagent RNAiso Plus was purchased from Bao Biological Engineering Co., Ltd., the reverse transcription kit High Capacity cDNA Reverse Transcription Kits was purchased from Invitrogen, and the fluorescent quantitative PCR kit Power SYBR Green PCR Master Mix was purchased from Invitrogen.

[0065] The primer sequences of DLK1 and housekeeping gene β-actin are as follows:

[0066] DLK1: Upstream primer: CTTTCGGCCACAGCACCTAT (SEQ ID NO: 1); Downstream primer CCTCGCAGAATCCATTTTGGG (SEQ ID NO: 2).

[0067] β-actin: upstream primer: CTCCATCCTGGCCTCGCTGT (SEQ ID NO: 3); downstream primer GCTGTCACCTTCACCGTTCC (SEQ ID NO: 4)....

Embodiment 3

[0084] Example 3, the expression of DLK1 in the tissues of patients with gastrointestinal stromal tumors

[0085] 2.1 Main reagents

[0086] DLK1 antibody (ab21682) and horseradish peroxidase-labeled secondary antibody goat polyclonal anti-rabbit IgG (ab6721) were purchased from abcam. DAB chromogen and its substrate kit were purchased from Thermo Fisher. The rest of the reagents were of domestic analytical grade.

[0087] 2.2 Construction of gastrointestinal stromal tumor tissue chip array

[0088] Tumor tissues of patients with gastrointestinal stromal tumors were obtained from Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine. The construction of the chip array was completed by Suzhou Xinxin Biotechnology Co., Ltd., with a lattice diameter of 1.6mm and a layer thickness of 3mm. Chip 1 included tumor tissues of 139 patients with gastrointestinal stromal tumors and corresponding adjacent normal tissues, and chip 2 included tumor tissues of 189 p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a DLK1 (delta drosophila homolog-like1) gene in preparation of a gastrointestinal stromal tumor diagnostic reagent. The new discovery of the invention can be applied to development of drugs or kits based on RT-PCR, PCR, immunodetection, in-situ hybridization, gene chip and other technologies for diagnosis of gastrointestinal stromal tumors. The invention puts forward for the first time that detection based on DLK1 gene and its products in serum / tissue can be utilized to achieve early diagnosis of GIST or carry out prognosis on GIST patients undergoing surgical treatment, the high-throughput chip screening + real-time quantitative PCR validation established on the gene level and large sample clinical sample validation on the protein level have reliable result, and DLK1 can significantly distinguish tumors and nontumors, high-risk tumors and low-risk tumors both on the gene level and protein level, and the result repeatability is good. Thus, DLK1 gene has good clinical application value.

Description

technical field [0001] The invention belongs to the field of biomedicine; more specifically, the invention relates to the application of DLK1 gene in the preparation of diagnostic reagents for gastrointestinal stromal tumors. Background technique [0002] Gastrointestinal stromal tumor (GIST) is the most common tumor of mesenchymal origin in the gastrointestinal tract, mainly occurring in the stomach (about 70%). In recent years, the incidence of GIST has been increasing rapidly year by year. The previous epidemiological data showed that the incidence of GIST was about 7-15 / million people / year. In recent years, the incidence of GIST has exceeded 20 / hundred 10,000 people / year. In 2009, the epidemiological survey data in China showed that the incidence rate reached about 30 / million people / year. It is estimated that the number of new cases in China every year can reach about 40,000-50,000. GIST has become the most common malignant tumor in the digestive tract after gastric c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/574
Inventor张志刚曹晖徐佳汪明
OwnerSHANGHAI INST OF ONCOLOGY