Endolysin sourced from salmonella bacteriophage and application thereof
A Salmonella and endolysin technology, applied in the field of endolysin, can solve the problem of less research on the prevention and control of Gram-negative bacteria, and achieve a significant bactericidal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Prediction of endolysin protein function
[0028] The present inventor isolated a Salmonella virulent phage STP4-a from sewage. Through the whole genome sequencing and analysis, it is identified that the protein encoded by the phage gp193 has 65% similarity with the Escherichia coli phage T4 lysozyme in the amino acid sequence. The domain prediction analysis of gp193-encoded protein LysSTP4 was performed using InterProScan software. The domain prediction results are as follows figure 1 As shown, the 24-150 amino acid interval of LysSTP4 is a highly conserved functional region, which belongs to the Phage_lysozyme family (PF00959). This family can cleave glycosidic bonds in peptidoglycan in the cell wall of prokaryotic cells, releasing progeny phages.
Embodiment 2
[0029] Example 2: High expression of endolysin in Escherichia coli
[0030] 1. Construction of recombinant plasmids
[0031] According to the endolysin gene sequence (SEQ ID No: 2), design primers, upstream primer: CGGGATCCATGAACATTTTTGACATGCTTCG (SEQ ID No: 3), downstream primer: CCGCTCGAGTCATATGTTTTCATATGCTTTCCAA (SEQ ID No: 4), respectively set limits at the upstream and downstream primer ends Sexual endonucleases BamH Ⅰ and Xho Ⅰ. The endolysin gene was amplified by PCR, and 25 μL of the PCR recovered product was cloned into the multiple cloning site BamH I and Xho I of the pET-30a vector to obtain a recombinant plasmid, which was transformed into Escherichia coli BL21(DE3). Pick a single clone to LB liquid medium for overnight shaking culture, extract the plasmid as a template for PCR identification, the results show that the plasmid has the nucleotide sequence shown in SEQ ID No: 2, and the protein expressed by the gene is named LysSTP4, The gene encodes the amino acid...
Embodiment 3
[0034] Example 3: Taking Salmonella ATCC14028 as the target bacterium to test the antibacterial effect of endolysin LysSTP4
[0035] Pick a single colony of Salmonella ATCC14028 into 300mL nutrient broth medium, cultivate overnight, add chloroform with a final concentration of 5% to the bacterial solution, 15min, centrifuge the cells and wash them twice with pure water, then store them at -80°C, before measuring the activity , the bacterial pellet was reconstituted with 50mmol / L Tris-HCl pH8.2 containing 0.1% Triton X-100. Add 100 μL of recombinant protein LysSTP4 solution (100 μg / mL) to 900 μL of bacterial reconstitution solution, and incubate at 37°C until the lysis effect is obvious. Tris buffer and lysozyme (100 μg / mL) were used as the blank group and the positive control group were mixed with the bacterial reconstitution solution, cultivated under the same conditions, and the OD450 value was measured with a microplate reader. The decrease in the absorbance value reflected...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap