Endolysin sourced from salmonella bacteriophage and application thereof

A Salmonella and endolysin technology, applied in the field of endolysin, can solve the problem of less research on the prevention and control of Gram-negative bacteria, and achieve a significant bactericidal effect

Active Publication Date: 2015-08-12
OCEAN UNIV OF CHINA
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the domestic use of genetic engineering technology to construct endolysin-producing strains has made some progress, an important problem in the research and production p...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endolysin sourced from salmonella bacteriophage and application thereof
  • Endolysin sourced from salmonella bacteriophage and application thereof
  • Endolysin sourced from salmonella bacteriophage and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Prediction of endolysin protein function

[0028] The present inventor isolated a Salmonella virulent phage STP4-a from sewage. Through the whole genome sequencing and analysis, it is identified that the protein encoded by the phage gp193 has 65% similarity with the Escherichia coli phage T4 lysozyme in the amino acid sequence. The domain prediction analysis of gp193-encoded protein LysSTP4 was performed using InterProScan software. The domain prediction results are as follows figure 1 As shown, the 24-150 amino acid interval of LysSTP4 is a highly conserved functional region, which belongs to the Phage_lysozyme family (PF00959). This family can cleave glycosidic bonds in peptidoglycan in the cell wall of prokaryotic cells, releasing progeny phages.

Embodiment 2

[0029] Example 2: High expression of endolysin in Escherichia coli

[0030] 1. Construction of recombinant plasmids

[0031] According to the endolysin gene sequence (SEQ ID No: 2), design primers, upstream primer: CGGGATCCATGAACATTTTTGACATGCTTCG (SEQ ID No: 3), downstream primer: CCGCTCGAGTCATATGTTTTCATATGCTTTCCAA (SEQ ID No: 4), respectively set limits at the upstream and downstream primer ends Sexual endonucleases BamH Ⅰ and Xho Ⅰ. The endolysin gene was amplified by PCR, and 25 μL of the PCR recovered product was cloned into the multiple cloning site BamH I and Xho I of the pET-30a vector to obtain a recombinant plasmid, which was transformed into Escherichia coli BL21(DE3). Pick a single clone to LB liquid medium for overnight shaking culture, extract the plasmid as a template for PCR identification, the results show that the plasmid has the nucleotide sequence shown in SEQ ID No: 2, and the protein expressed by the gene is named LysSTP4, The gene encodes the amino acid...

Embodiment 3

[0034] Example 3: Taking Salmonella ATCC14028 as the target bacterium to test the antibacterial effect of endolysin LysSTP4

[0035] Pick a single colony of Salmonella ATCC14028 into 300mL nutrient broth medium, cultivate overnight, add chloroform with a final concentration of 5% to the bacterial solution, 15min, centrifuge the cells and wash them twice with pure water, then store them at -80°C, before measuring the activity , the bacterial pellet was reconstituted with 50mmol / L Tris-HCl pH8.2 containing 0.1% Triton X-100. Add 100 μL of recombinant protein LysSTP4 solution (100 μg / mL) to 900 μL of bacterial reconstitution solution, and incubate at 37°C until the lysis effect is obvious. Tris buffer and lysozyme (100 μg / mL) were used as the blank group and the positive control group were mixed with the bacterial reconstitution solution, cultivated under the same conditions, and the OD450 value was measured with a microplate reader. The decrease in the absorbance value reflected...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology and particularly relates to endolysin sourced from salmonella bacteriophage and an application thereof. The amino acid sequence of the endolysin sourced from the salmonella bacteriophage includes the total of the partial of the amino acid sequence represented as the SEQ ID No.1. Sequence structure analysis proves that the protease is a lyase which can lysing bacterial cell walls in the bacteriophage. A test proves that the protein formed by the amino acid sequence is good in bactericidal activity. The endolysin, when being expressed and purified by a suitable expression vector on market, can achieve a significant sterilization effect, so that the endolysin can be used for preparing a bacterial inhibitor of salmonella.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an endolysin derived from Salmonella phage and application thereof. Background technique [0002] Salmonella is a Gram-negative straight bacillus and is an important zoonotic pathogen. Studies at home and abroad have shown that foodborne diseases caused by Salmonella have repeatedly topped the list. With the extensive and long-term use of antibiotics, the increasingly serious drug-resistant Salmonella in food and the environment has affected the treatment of human Salmonella infection. Whether to develop new biological antibacterial agents to replace chemical antibiotics is currently a challenge for researchers. a challenge. [0003] Phage endolysins are a class of lytic enzymes capable of cleaving bacterial cell walls. Although the ability of phage endolysin to lyse bacteria was first reported in 1957, it was not until 2001 that Nelson et al. confirmed that purified r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21A01N47/44A01P1/00C12R1/19
Inventor 王静雪林洪李萌李梦哲
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap