Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for cultivating cotton resisting verticillium dahliae

A technology for resistance to verticillium wilt and cotton, applied in the biological field, can solve the problems of staying and not yet conducting large-scale field trials.

Active Publication Date: 2015-10-21
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These studies are looking for disease resistance genes in host cotton, and most of them are still in the stage of small-scale experiments in the laboratory, and large-scale field experiments have not yet been carried out.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating cotton resisting verticillium dahliae
  • Method for cultivating cotton resisting verticillium dahliae
  • Method for cultivating cotton resisting verticillium dahliae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Construction of VDH1i expression vector

[0043] Utilize CTAB method to extract Verticillium dahliae V592 genomic DNA, utilize following primer to use this genomic DNA as template, carry out PCR amplification: Upstream primer (5'→3'): G GATCC TTCGTGTATTCGGAGTTCTG downstream primer (underlined BamHI restriction site) (5'→3'): G AATTC GATTGCTCTGTTTGCTGGA (the underline is the EcoRI restriction site). The PCR product was connected to the pGEM-T vector (purchased from TIANGEN Company, Cat. No. VT202-02) to obtain a recombinant vector. Using the above upstream primers and pGEM-T vector universal reverse primer M13R (5'→3': CAGGAAACAGCTATGACC), the recombinant vector inserted in the forward direction was identified by PCR amplification and sequenced, and the sequencing results showed that it contained the sequence shown in SEQ ID NO.1 The recombinant vector of the DNA molecule was named pGEMT-VDH1i1. Use the following primers to perform PCR amplification with...

Embodiment 2

[0044] Example 2 Agrobacterium-mediated transformation of wild-type cotton WC-CK

[0045] 1. Transformation of Agrobacterium with VdH1 RNAi expression vector

[0046] The constructed VdH1 RNAi expression vector was introduced into Agrobacterium competent cells by electric shock transformation, and the specific operations were as follows:

[0047] (1) Agrobacterium competent cells EHA105 were taken out at -80°C and thawed on ice.

[0048] (2) 1 μl of VdH1 RNAi expression vector plasmid was injected into the Agrobacterium liquid, and placed on ice.

[0049] (3) Pour the mixed Agrobacterium solution into the electric shock cup (BIO-RAD company, article number 165-2089), and electric shock for 2 seconds under 1500v voltage (BIO-RAD company, Gene Pulser Xcell electroporator).

[0050] (4) Add LB into the electric shock cup, suck out the mixture and pour it into the EP tube.

[0051] (5) Shake in a shaker at 28°C and 160 rpm for 45 minutes.

[0052] (6) Spread the bacterial liqu...

Embodiment 3

[0060] Example 3 Southern blot determines the copy number of the inserted gene in transgenic cotton

[0061] A. The CTAB method was used to extract the genomic DNA of the transgenic cotton and wild-type cotton WC-CK in Example 1.

[0062] B. The extracted DNA was digested with HindⅢ

[0063] Digestion system: DNA 100μg, 10×buffer 40μl, enzyme 35μl, add H 2 O to 400 μl, 37 ° C, 24 hours. Take 5ul electrophoresis to check whether the enzyme digestion is complete. Add 240μl isopropanol to precipitate the digested product, and finally dissolve it in about 40μl ddH 2 Add Loading Buffer to O; keep warm at 65°C for 5-10 minutes before sample application.

[0064] C. Electrophoresis

[0065] 0.9% agar (0.5×TBE); 50V, 18-24 hours; finally reverse electrophoresis for 5min.

[0066] D. Gel treatment

[0067] (1) After electrophoresis, take pictures; ddH 2 O rinse gel;

[0068] (2) Soak the gel in 0.2M HCl, and shake gently on a decolorizing shaker for about 20 minutes until the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for cultivating cotton resisting verticillium dahliae. The method comprises the step that genes of a sequence shown in the SEQ ID NO.1 and genes of the inverted repeat sequence are guided into a cotton genome. According to the method, verticillium dahliae virulence genes are guided into a cotton plant, so that the genes are transcribed in the cotton plant to generate a double-stranded RNA structure corresponding to the verticillium dahliae virulence genes, Dicer-like protein in the cotton plant cuts the double-stranded RNA structure into siRNA with the size being 20-25nt, and the siRNA can recognize the virulence genes mRNA complementary with the sequence in verticillium dahlia infecting the cotton, degrades the virulence genes and lowers the pathogenicity of verticillium dahlia.

Description

technical field [0001] The present invention generally relates to the field of biotechnology, in particular to a method for cultivating cotton resistant to verticillium wilt. Background technique [0002] Cotton verticillium wilt seriously threatens the production of cotton and the development of related industries, because the problem of cotton production reduction caused by verticillium wilt is very serious, causing great economic losses to cotton farmers and the country. Cotton verticillium wilt has become one of the main obstacles to the sustainable development of cotton production, known as "the cancer of cotton" (Jian Guiliang et al. 2003), and has become a prominent problem restricting cotton production. [0003] Cotton verticillium wilt is caused by the soil filamentous fungus Verticillium dahliae Kleb. It is a soil-borne vascular disease, and the pathogenic bacteria mutate quickly, with wide distribution, heavy damage, and long survival time. It is one of the most ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/84A01H5/00
Inventor 郭惠珊张涛
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com