Humicola-sourced high-temperature acid beta-glucosidase HiBgl3C as well as gene and application thereof
A glucosidase, high temperature technology, applied in the field of genetic engineering, can solve the problems such as the inability to meet the application requirements of the medium-alkaline hydrolysis process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Cloning of Humicola insolens Y1 CGMCC 4573 β-glucosidase coding gene bgl3C
[0047] According to the H.insolens genome sequencing sequence, design gene-specific primers:
[0048] PF:GGG ACTAGT ATGGGTATCTTCGGTCTCGC
[0049] PR: GGG GCGGCCGC TCAAACATCAATGCTGCCCGTC
[0050]The RNA of Humicola insolens Y1 CGMCC 4573 was extracted and cDNA was obtained by reverse transcription. PCR amplification was performed using Humicola insolens Y1 CGMCC 4573cDNA as a template. The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 2 min and 30 s, and after 35 cycles, incubation at 72°C for 10 min. A fragment of about 2200bp was obtained, which was recovered and connected with the pEASY-T3 vector and sent to Ruibo Xingke Biotechnology Co., Ltd. for sequencing.
[0051] The sequencing result is β-glucosidase gene Hibgl3C gene 2151bp (signal peptide removed), encoding 717 ...
Embodiment 2
[0052] The preparation of embodiment 2 recombinant xylanase
[0053] The expression vector pPIC9 was subjected to double digestion (Spe I+Not I), and the gene bgl3C encoding β-glucosidase HiBgl3C was double-digested (Spe I+Not I) at the same time to cut out the gene encoding mature β-glucosidase The fragment (not including the signal peptide sequence) was connected with the expression vector pPIC9 to obtain the recombinant plasmid pPIC-Hibgl3C containing the Humicola β-glucosidase gene Hibgl3C and transform it into Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain GS115 / Hibgl3C.
[0054] A recombinant Pichia strain containing the complete gene was constructed in the same way.
[0055] The GS115 strain containing the recombinant plasmid was inoculated in 400mL of BMGY culture medium, shaken at 250rpm at 30°C for 48h, and then collected by centrifugation. Then resuspend in 200mL BMMY medium, shake culture at 250rpm at 30°C. After 48 hours of induction, the...
Embodiment 3
[0056] Example 3 Activity analysis of recombinant β-glucosidase
[0057] Determination of β-glucosidase activity: the amount of the product p-nitrophenol (pNP) generated by enzymatic hydrolysis of the substrate pNPG was measured at 405 nm.
[0058] Reaction steps: mix 125μl 2mM pNPG substrate with 125μl buffer, add 250μl appropriately diluted enzyme solution, react at 60°C for 10min, add 1.5mL 1M Na 2 CO 3 Terminate the reaction and measure the OD using a spectrophotometer 405 value.
[0059] Definition of enzyme activity unit: 1 β-glucosidase activity unit (U) is defined as the amount of enzyme required to decompose the substrate pNPG to generate 1 μmol p-nitrophenol (pNP) per minute under given reaction conditions.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
