Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant human/baboon chimeric uricase protein and preparation method thereof

A uricase and protein technology, applied in the field of medicine, can solve the problem of less than 40% homology, achieve the effects of reducing immunogenicity, reasonable design, and simple preparation process

Active Publication Date: 2015-11-18
SHANXI JINBO BIO PHARMA CO LTD
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, uricase (Uricozyme) derived from Aspergillus flavus has been approved in France and Italy, but its sequence has less than 40% homology with the deduced human uricase; EU or approved
However, due to the rejection reaction caused by the difference with humans, coupled with the influence of PEGylation, its immunogenicity is still strong

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human/baboon chimeric uricase protein and preparation method thereof
  • Recombinant human/baboon chimeric uricase protein and preparation method thereof
  • Recombinant human/baboon chimeric uricase protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A method for recombinant expression of recombinant human / baboon chimeric uricase protein JBUO, comprising the steps of:

[0033] (1) Design primers according to the optimized nucleotide sequence of JBUO (Sequence List 1), which need to include enzyme cutting sites, arranged from 5`-3` as follows:

[0034] JBP1: GGAATTCCATATGGCCCATTATCACAACGACTATAAGAA

[0035] JBP2: CCGCTCGAGttaCAGGCGGCTACTCAGTTTGCGT

[0036] Primers were diluted to 50 pmol / [mu]l prior to the PCR step.

[0037] (2) Use Tag enzyme to carry out the PCR step, agarose gel electrophoresis to detect that the JBUO band is located at about 1000bp, recover the target gene from the gel, use NdeI and XhoI to cut the gene enzyme into the sticky end, treat the pET-26b vector in the same way, and add T4DNA Ligase, ligated for 12 hours at 4°C, and transformed into Escherichia coli DH5α. Use the kanamycin sulfate-LB plate to screen and pick out the white spot clone, use the alkaline lysis method or boiling method of ...

Embodiment 2

[0042] A method for purifying recombinant human / baboon chimeric uricase protein JBUO, comprising the steps of:

[0043] (1) Choose an anion exchange column with a suitable capacity, and use 0.1M Na with pH 11 2 CO 3 The buffer solution balances the column material, and the solution containing the JBUO protein prepared in Example 1 is slowly loaded onto the column.

[0044] (2), use 0.1M NaHCO with pH8.5 3 Elute the impurity protein with the buffer, wash at least 5 times the volume of the column; then gradually increase the NaCl salt concentration of the buffer to 1.5M, and wash another 5 times the volume of the column to fully elute other impurities.

[0045] (3), use pH11 Na 2 CO 3 The buffer solution flows through the column, and the NaCl salt concentration of the buffer is gradually increased to 1M, and the eluted JBUO protein is collected.

[0046] (4) The molecular sieve on the purified JBUO protein was used to identify the aggregated form, and the peak position was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant human / baboon chimeric uricase protein sequence as well as a preparation process and application thereof. The uricase protein is JBUO for short, is derived from a baboon uricase protein sequence and is subjected to humanized mutation and activity enhanced mutation, so that the uricase protein simultaneously has the characteristics of low immunogenicity and high catalytic activity. JBUO codons are optimized and then cloned to a prokaryotic expression vector to convert escherichia coli, the collected recombinant protein content can reach 10mg / per kg of dry fungus, and the biological activity of JBUO is greater than 6 IU / mg. The uricase protein disclosed by the invention can be used for efficiently and quickly obtaining low-immunogenicity novel pure uricase products highly homologous with a human body, can be widely used for preparing medicines, foods and other products for treating diseases related to high uric acid of the human body, and has very high use values.

Description

technical field [0001] The invention belongs to the technical field of medicine, and in particular relates to a uricase chimeric protein that is highly homologous to human body and has high biological activity based on baboon uricase and is used as an active ingredient in the preparation of medicines for treating gout or hyperuricemia. application. Background technique [0002] Gout and hyperuricemia are common diseases that endanger human health. According to statistics, the incidence of hyperuricemia has reached 10% of the population. Gout is an acute arthritis caused by the deposition of urate crystals in the joints due to high blood uric acid levels. Uric acid is the product of the human body in the process of metabolizing purine. Purine metabolism disorder will lead to excessive accumulation of uric acid, which will increase the concentration of uric acid in the blood and cause hyperuricemia. Long-term excessive uric acid can easily cause gout and increase the risk of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/06C12N15/53C12N15/70A61K38/44A61P19/06
CPCA61K38/00C12N9/0048C12Y107/03003
Inventor 杨霞
Owner SHANXI JINBO BIO PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com