Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probiotics compound for crowds with blood types of A, B and O and method and application of probiotics compound

An ABO blood type, probiotic technology, applied in the field of biotechnology, to achieve the effect of preventing and curing intestinal diseases

Inactive Publication Date: 2015-12-02
JINAN UNIVERSITY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the study needs more samples to ensure the repeatability of the results and reduce the interference in areas such as living habits and nutritional intake among individuals to ensure the validity of the results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probiotics compound for crowds with blood types of A, B and O and method and application of probiotics compound
  • Probiotics compound for crowds with blood types of A, B and O and method and application of probiotics compound
  • Probiotics compound for crowds with blood types of A, B and O and method and application of probiotics compound

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Collection of Human Fecal Samples and Blood Samples

[0043] In order to exclude the influence of individual differences such as host dietary habits, medical history, and age, we recruited 171 male volunteers. All volunteers are 20 to 30 years old and live in Guangdong Province, China. In addition, they had a normal body weight (BMI=18.5-24.9 kg / m2), and those who participated in the survey had not taken antibiotics in the past month. Each participant completed a detailed medical, lifestyle and dietary questionnaire.

[0044] After human fecal samples were collected, they were frozen and stored at -80°C to extract fecal DNA, and the concentration and integrity of the extracted DNA were analyzed by ultramicro spectrophotometer nanodrop2000 and agarose gel electrophoresis. At the same time, medical staff collected 2mL of volunteer blood intravenously into EDTA.2K blood collection tubes, and accurately identified ABO blood types through positive and negative t...

Embodiment 2

[0046] Example 2: 16SrRNA gene sequencing and data processing filtering and OTU statistics:

[0047] Use the qualified samples to construct the library: dilute the qualified genomic DNA as a template, use primer 907R (CCGTCAATTCMTTTGAGTTT) and primer 517F (ACTCCTACGGGAGGCAGCAG) to amplify the V3-V5 region of the 16S rRNA gene, and screen the fragments with magnetic beads; finally, Qualified libraries were used for emPCR and sequencing. Use the data obtained after getting off the machine to carry out the next step of bioinformatics analysis.

[0048] The original data obtained by sequencing has a certain proportion of interference data. In order to make the results of information analysis more accurate and reliable, the original data is first spliced ​​and filtered to obtain valid data. Then, OTUs clustering and species taxonomy analysis were performed based on the valid data, and the OTUs and species annotations were combined to obtain the basic analysis results of OTUs and t...

Embodiment 3

[0050] Example 3: Analysis of differences in intestinal flora of different blood types

[0051] By calculating the Alpha diversity of gut microbes in ABO blood type, we observed a significant decrease in the gut microbial diversity of individuals with blood type A. Table 1 shows that the shannon index is the smallest and the simpson index is the largest in blood type A blood samples, which shows that the species diversity of intestinal bacteria composition of blood type A people is the lowest (Shannon index is 2.59436, P<0.05; Simpson index is 0.16220, P<0.05, t test), B blood type people had the highest diversity of intestinal bacteria (Shannon index was 2.78766, P<0.05; Simpson index was 0.1307, P<0.05, t test). The human intestinal microbial flora is a huge and complex ecosystem, which accounts for about 80% of the total microecological bacteria in the whole body. The diversity of the intestinal flora is very important. There are a large number of diseases such as colorecta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probiotics compound for crowds with the blood types of A, B and O and a method and application of the probiotics compound. A high throughput Roche 454 platform is used, the influences of individual differences of dietary habits, medical history, ages and the like of hosts are excluded, sequencing analysis is carried out on the intestinal flora 16S rRNA gene of the adult crowds, the differences of intestinal microbial diversity of the blood types of A, B and O are analyzed, difference intestinal florae influencing the individual health among the blood types of A, B and O are found, the probiotics compound for the blood types A, B and O is designed in an individualized mode on the basis that the roles played by difference probiotics on the human bodies are known and the susceptibility of the blood types A, B and O on different diseases is combined, and thus the functions and effects of preventing or treating diseases, improving the immunity of the human bodies, improving host intestinal flora composition, promoting digestive absorption of nutrient substances, restricting harmful bacteria and harmful substances and the like are achieved.

Description

technical field [0001] The invention belongs to the technical field of biotechnology, and in particular relates to a probiotic compound designed for people with ABO blood type based on differences in the distribution of intestinal flora and its method and application. Background technique [0002] Probiotics refer to a type of intestinal physiological bacteria that are beneficial to human life and health. After ingestion in sufficient quantities, they can produce one or more special health benefits to the human body, including improving gastrointestinal health, regulating the immune system, Relieve lactose intolerance, lower cholesterol, prevent constipation and diarrhea, etc. As the health effects of probiotics are more and more understood and accepted by consumers, the forms of probiotic preparations on the market are becoming more and more diverse. Although they are sold in the form of personalized production, personalized service and personalized ingredient packaging, bu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A23L1/29A23L1/30A61K35/745A61P1/00A61K35/744A61K35/741
CPCA61K35/745A23V2002/00A61K35/741A61K35/744A23V2200/3204A61K2300/00
Inventor 尹芝南杨恒文钟辉王鹏陈敏翟娅菲
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com